WMJ 03 2011

UNITED STATES
vol. 57
MedicalWorld
Journal
Official Journal of the World Medical Association, INC
G20438
Nr. 3, June 2011
• Global Forum on Human Resources for Health
• Leadership and the Medical Profession
• Physician Suicide and Resilience
wmj 3 2011 5CS.indd I 6/21/11 9:32 AM
Cover picture from China
ii
Editor in Chief
Dr. Pēteris Apinis
Latvian Medical Association
Skolas iela 3, Riga, Latvia
Phone +371 67 220 661
peteris@arstubiedriba.lv
editorin-chief@wma.net
Co-Editor
Dr. Alan J. Rowe
Haughley Grange, Stowmarket
Suffolk IP143QT, UK
Co-Editor
Prof. Dr. med. Elmar Doppelfeld
Deutscher Ärzte-Verlag
Dieselstr. 2, D-50859 Köln, Germany
Assistant Editor Velta Pozņaka
wmj-editor@wma.net
Journal design and
cover design by Pēteris Gricenko
Layout and Artwork
The Latvian Medical Publisher
“Medicīnas apgāds”, President Dr. Maija Šetlere,
Katrīnas iela 2, Riga, Latvia
Cover painting:
“Bell Sound from the Monastery” by dental
radiologist, Dr. WANG Zhaowu from a hospital
in Beijing. In Chinese paintings, they try to
include all senses in one visual picture to make
you hear the sound, see the moving water, feel
the smell of the trees and flowers…
Publisher
The World Medical Association, Inc. BP 63
01212 Ferney-Voltaire Cedex, France
Publishing House
Publishing House
Deutscher-Ärzte Verlag GmbH,
Dieselstr. 2, P.O.Box 40 02 65
50832 Cologne/Germany
Phone (0 22 34) 70 11-0
Fax (0 22 34) 70 11-2 55
Producer
Alexander Krauth
Business Managers J. Führer, N. Froitzheim
D. Weber
50859 Köln, Dieselstr. 2, Germany
IBAN: DE83370100500019250506
BIC: PBNKDEFF
Bank: Deutsche Apotheker- und Ärztebank,
IBAN: DE28300606010101107410
BIC: DAAEDEDD
50670 Cologne, No. 01 011 07410
Advertising rates available on request
The magazine is published bi-mounthly.
Subscriptions will be accepted by
Deutscher Ärzte-Verlag or
the World Medical Association
Subscription fee € 22,80 per annum
(incl. 7% MwSt.). For members of the World
Medical Association and for Associate
members the subscription fee is settled by the
membership or associate payment. Details of
Associate Membership may be found at the
World Medical Association website www.wma.
net
Printed by
Deutscher Ärzte-Verlag
Cologne, Germany
ISSN: 0049-8122
Dr. Wonchat SUBHACHATURAS
WMA President
Thai Health Professional Alliance
Against Tobacco (THPAAT)
Royal Golden Jubilee, 2 Soi
Soonvijai, New Petchburi Rd.
Bangkok,Thailand
Dr. Leonid EIDELMAN
WMA Chairperson of the Finance
and Planning Committee
Israel Medical Asociation
2 Twin Towers, 35 Jabotinsky St.
P.O.Box 3566, Ramat-Gan 52136
Israel
Dr. Masami ISHII
WMA Vice-Chairman of Council
Japan Medical Assn
2-28-16 Honkomagome
Bunkyo-ku
Tokyo 113-8621
Japan
Dr. Dana HANSON
WMA Immediate Past-President
Fredericton Medical Clinic
1015 Regent Street Suite # 302,
Fredericton, NB, E3B 6H5
Canada
Sir Michael MARMOT
WMA Chairperson of the Socio-
Medical-Affairs Committee
British Medical Association
BMA House,Tavistock Square
London WC1H 9JP
United Kingdom
Dr. Guy DUMONT
WMA Chairperson of the Associate
Members
14 rue des Tiennes
1380 Lasne
Belgium
Dr. José Luiz
GOMES DO AMARAL
WMA President-Elect
WMA Chairperson of the Socio-
Medical-Affairs Committee
Associaçao Médica Brasileira
Rua Sao Carlos do Pinhal 324
Bela Vista, CEP 01333-903
Sao Paulo, SP Brazil
Dr.Torunn JANBU
WMA Chairperson of the Medical
Ethics Committee
Norwegian Medical Association
P.O. Box 1152 sentrum
0107 Oslo
Norway
Dr.Frank Ulrich MONTGOMERY
WMA Treasurer
Herbert-Lewin-Platz 1
(Wegelystrasse)
10623 Berlin
Germany
Dr. Mukesh HAIKERWAL
WMA Chairperson of Council
58 Victoria Street
Williamstown, VIC 3016
Australia
Dr. Otmar KLOIBER
WMA Secretary General
13 chemin du Levant
France 01212 Ferney-Voltaire
France
World Medical Association Officers, Chairpersons and Officials
Official Journal of the World Medical Association
Opinions expressed in this journal – especially those in authored contributions – do not necessarily reflect WMA policy or positions
www.wma.net
wmj 3 2011 5CS.indd Sec1:ii 6/21/11 9:32 AM
81
A woman who uses cosmetics may cover her face with some 80 ki-
lograms of various protective and nourishing creams during her life-
time. At least 200 different compounds used in cosmetics may have
harmful effects on one’s health. Most perfume ingredients are based
on oil products. As a rule, these are secret combinations that are not
patented. So, a woman can never be sure about what she spreads
over her face.
Household cleaning chemicals turn out to be much more danger-
ous than we have thought in the past. 70.000 new components have
been introduced in the past 60 years. 15.000 of them have never
been tested for harmful side-effects. Furthermore, for 99% of these
agents there is no information about possible side effects on chil-
dren’s health.
Laundry detergents contain surfactants that end up in our water
supply.This is just another insult to our precarious water supply.
This year more attention is being paid to antimicrobial resistance by
the World Health Organization and the World Medical Associa-
tion than in the past. There is because of an obvious reason: more
and more antibiotic-resistant bacteria are being encountered. Al-
though the main concern has been Mycobacterium tuberculosis, a
greater problem exists.
Our focus has been on antibacterial therapy for human use. How-
ever, more than 95% of world’s antibiotics are used for veteri-
nary purposes and zootechnics. Enormous fish farms ponds and
confined sea bays are routinely scattered with fish food that also
contains antibiotics and various substances that improve the fla-
vour and colour of fish products. The antibiotics affect not only
the bacteria in the water into which they have been placed, but
they spread widely by flowing water. As a result, the qualities of
bacteria all over the world are affected. Antibacterial medicine
that has been fed to domestic birds and animals present an even
greater problem in the development of antibiotic-resistant strains
of bacteria.
The problem of antimicrobial resistance in animals is spreading to
becoming a problem in human medicine. This means we have to
do everything possible to reduce uncontrolled use of antimicrobial
substances in the processes of producing fish, poultry and meat.
Although we cannot anticipate chemical or nuclear catastrophes,
the Hungarian aluminum refinery toxic sludge spill and the recent
nuclear plant disaster in Japan should heighten our concern. The
World Medical Association should raise its voice and continue
to speak firmly to our governments about these risks. This time it
should also be about the uncontrolled use of antibiotics and the
widespread use of chemicals in cleaning and washing and in cos-
metics.
Dr. Pēteris Apinis,
President of Latvian Medical Association
Editorial
wmj 3 2011 5CS.indd 81 6/21/11 9:32 AM
82
Reviewing Progress and Renewing Commitment to Health Workforce
Development: the 2nd
Global Forum on Human Resources for Health
Summary
An adequately available and equitably dis-
tributed health workforce is critical in ensur-
ing the delivery of healthcare services that
meet local populations’healthcare needs. Yet,
the reality is that many countries are suffer-
ing from a shortage and mal-distribution of
their health workforce. In 2008 in an effort
to address these issues, the Kampala Declara-
tion and Agenda for Global Action (KD-AGA)
was adopted at the 1st
Global Forum on Hu-
man Resources for Health held in Kampala,
Uganda.The KD-AGA is a set of inter-con-
nected strategies and policy actions that are
required at global,regional and national levels
to address these issues.On January 25th
,2011
in Bangkok, Thailand the 2nd
Global Forum
on Human Resources for Health convened to
review the progress made in the implementa-
tion of the KD-AGA and renew the com-
mitment to addressing human resources for
health. This paper presents the background
and achievements of the 2nd
Global Forum
on Human Resources for Health in address-
ing health workforce challenges.
Introduction: global health
workforce challenges
It is a well-recognized fact that health-
care workers are an essential component of
health systems,without which health devel-
opment objectives, such as the health Mil-
lennium Development Goals (see box  1)
cannot be achieved[1]. In 2006, however,
the World Health Organization (WHO)
warned that 57 countries were affected by
severe shortages of health workers (i.e.,,
fewer than 2.3 physicians, nurses, and mid-
wives per 1000 population), estimating the
global shortfall of health workers at 4.3
million[2]. Regional disparities in the avail-
ability of healthcare workers are stagger-
ing: for example, Africa alone carries 25%
of the world’s disease burden yet has only
3% of the world’s health workers and 1% of
the world’s financial resources to meet that
challenge[3].Healthcare workforce gaps are
even greater in absolute numbers in south-
east Asia, as a result of the large population
of countries such as India,Pakistan,Bangla-
desh, and Indonesia.
The global health workforce crisis is not
characterized exclusively by the shortage of
healthcare workers, but also by in-country
mal-distribution and poor motivation, per-
formance and quality of services rendered by
healthcare personnel. These system-wide de-
ficiencies that are prevalent in many countries
are caused by structural gaps due to limited
resources, and weak education and manage-
ment systems.The health workers’challenges
are compounded by and result in the interna-
tional migration of health workers.Shortages
in high-income countries exercise a “pull”
over poorly paid or poorly motivated health
workers in low- and middle-income coun-
tries.Spanning across sectors and constituen-
cies, the complex nature of these challenges
and the international dimension of the topic
illustrate how all relevant stakeholders should
collectively contribute to resolving these is-
sues within their respective roles in the health
workforce. For instance, while ministries of
health are typically the primary “users” and
employers of health workers,the ministries of
education should take the lead on pre-service
education and production of health workers.
Global Health Workforce Alliance
Giorgio Cometto Hirotsugu Aiga Mubashar Sheikh
wmj 3 2011 5CS.indd 82 6/21/11 9:32 AM
83
Global Health Workforce Alliance
The ministries of labour and ministries of
public services should be involved in design-
ing a possible package of additional financial
and non-financial incentives for those work-
ing in remote and hardship areas. Ministries
of foreign affairs and ministries of interna-
tional trade may need to broker agreements
with other countries in order to address the
issue of international migration of healthcare
workers,. In addition, most of these measures
may require the allocation of additional fi-
nancial resources by ministries of finance.
Furthermore, it is essential to engage health
professional associations and the private sec-
tor (both for-profit and not-for-profit), in
light of the rapidly growth of private health
service delivery and health workforce produc-
tion in the developing world [5].
To address the multi-faceted and complex na-
ture of health workforce issues through inter-
nationally partnering stakeholders,the Global
Health Workforce Alliance (the Alliance) was
launched in 2006, with the vision that “All
people, everywhere, shall have access to a skilled,
motivated and supported health worker”[6].
.The
Alliance has been consistently advocating for
the importance and value of addressing health
workforce issues in a multi-sectoral manner
at both global and country levels. One of the
key functions of the Alliance is to bring to-
gether various types of stakeholders in human
resources for health development, in order to
facilitate a shared understanding of problems
and a joint ownership of solutions to health
workforce challenges.To this end the Alliance
has been given a mandate to periodically con-
vene a Global Forum on Human Resources
for Health.
The Kampala Declaration and
Agenda for Global Action
In March 2008, the Alliance convened the
first-ever Global Forum on Human Resourc-
es for Health at Kampala, Uganda, which
resulted in the adoption of the Kampala Dec-
laration and Agenda for Global Action (KD-
AGA)[7].The AGA (see box 2) is composed
of six interconnected strategies, ranging from
investment strategies to policy, planning, or-
ganization, education, management and in-
formation issues, which provide an overarch-
ing framework for health workforce initiatives
and development efforts at all levels [8].
Box 2: The Agenda for Global Action
(adopted in Kampala, Uganda, in March
2008)
1. Building coherent national and
global leadership for health work-
force solutions.
2. Ensuring capacity for an informed
response based on evidence and
joint learning.
3. Scaling up health worker education
and training.
4. Retaining an effective, responsive
and equitably distributed health
workforce.
5. Managing the pressures of the in-
ternational health workforce market
and its impact on migration.
6. Securing additional and more pro-
ductive investment in the health
workforce.
The Agenda for Global Action offers an
ambitious vision of concerted action by all
stakeholders,at all levels,to comprehensively
address health workforce challenges. Its key
provisions contain relevant policy guidance,
which has been taken up through a number
of other policy initiatives, including, most
recently, the United Nations Global Strat-
egy for Women’s and Children’s Health [9].
Leadership. A coherent leadership strategy
for addressing the health workforce issues
needs to be underpinned by national health
workforce plans, which are comprehensive,
costed,and evidence-based.The plans should
project an appropriate scale and skills mix of
the health workforce, including, where rel-
evant, health workers and mid-level health
providers, cadres that are effective in scaling
up access to essential services, often with
limited costs, and with a higher likelihood
of being retained in rural areas [10, 11].
Evidence and joint learning. There is a need
to strengthen health workforce information
systems to monitor the availability, distribu-
tion and performance of health workers, as a
basic requirement to ensure that the develop-
ment of national health workforce plans is
conducted on the basis of documented needs
and according to an evidence-based approach.
Box 1: The health-related Millennium Development Goals[4].
The United Nations Millennium Development Goals (MDGs) are eight goals that
the 191 UN member states have agreed to achieve by 2015. The MDGs are part of
the United Nations Millennium Declaration, and have specific targets and indicators.
While all MDGs directly or indirectly influence health, 3 goals were formulated in
health-specific terms.The 3 health-related MDGs and their targets are highlighted in
bold in the list below:
The Eight Millennium Development Goals are:
1. to eradicate extreme poverty and hunger;
2. to achieve universal primary education;
3. to promote gender equality and empower women;
4. to reduce child mortality (target: reduce by two thirds the mortality rate among
children under five;
5. to improve maternal health (targets: reduce by three quarters the maternal mortality
ratio; achieve, by 2015, universal access to reproductive health);
6. to combat HIV/AIDS,malaria,and other diseases (targets; halt and begin to reverse
the spread of HIV/AIDS; achieve, by 2010, universal access to treatment for HIV/
AIDS for all those who need it; halt and begin to reverse the incidence of malaria
and other major diseases);
7. to ensure environmental sustainability; and
8. to develop a global partnership for development.
wmj 3 2011 5CS.indd 83 6/21/11 9:32 AM
84
Education and training. The absolute
number of available healthcare workers re-
mains insufficient in all countries affected
by the health workforce crisis. While other
factors such as mal-distribution and quality
of care issues are equally important, edu-
cation and training should be scaled up to
compensate for the workforce short-fall,
which was estimated at 3.5 million addi-
tional health workers for 49 low-income
countries alone [12].
Retaining the health workforce. It is es-
sential to ensure adequate incentives, sup-
portive supervision, opportunities for pro-
fessional development, and an enabling
working environment, in order to improve
retention rates, equitable workforce distri-
bution, and motivation and performance of
health workers. Each country has its unique
direct and underlying causes of domestic
migration and mal-distribution of health
workers. Therefore, a package of health
workforce retention strategies should be
carefully customized to suit each nation’s
individual needs.
International migration. While admitting
the freedom of international movement of
health workers as an essential human right,
there is a critical need to balance this with
the populations’ right to quality healthcare.
Therefore, international labour markets
should be shaped in favour of retention
of health workers in countries affected by
the health workforce crisis. The 63rd
World
Health Assembly adopted the WHO global
Code of practice on the international recruit-
ment of health personnel. The Code provides
a framework for member states and interna-
tional recruiters to collaborate in the ethical
management of health professionals’migra-
tory flows.
Investment.It has been estimated that a to-
tal of US $62 billion (inclusive of both train-
ing and employment) needs to be invested in
the healthcare workforce until 2015,in order
to achieve the health-related MDGs in 49
low-income countries. External assistance is
needed on a long-term basis to supplement
the shortfall in domestic resources, especial-
ly in low-income countries. Such support
should be provided in a well coordinated
manner among donors for greater efficiency
and effectiveness. In parallel, governments
of low-income countries should maximize
efforts to mobilize and invest adequate do-
mestic resources, and ensure their account-
able and efficient utilization.
The 2nd
Global Forum on
Human Resources for
Health: coming together
to review progress
The Kampala Declaration called upon the
Alliance to periodically review and report
progress. In compliance, almost three years
after the adoption of the KD – AGA, a 2nd
Global Forum on Human Resources for
Health was convened in Bangkok,Thailand
on January 27th
, 2011. The 2nd
Global Fo-
rum was co-hosted by the Alliance, WHO,
the Prince Mahidol Award Conference
(PMAC), and the Japan International Co-
operation Agency (JICA).
With approximately 1,000 participants
from over 100 countries in attendance, the
Forum enabled all types of stakeholders
from different constituencies and sectors to
come together, review progress and renew
their commitment to health workforce de-
velopment. Government participants came
not only from the ministries of health of
the affected countries, but also ministries
of education, labor, and finance. Beyond the
public sector, there was also a high level of
participation from the private not-for-profit
sector, professional associations, academic
and research institutes, development part-
ners, UN agencies, civil society organiza-
tions, and media. The three-day Forum was
composed of four types of activities: plenary,
parallel, side sessions and field trips around
Bangkok to places illustrating interesting
aspects of healthcare service organization
and innovative approaches to health work-
force development and management. The
event also featured a marketplace for booths
and posters, awards for outstanding health
workers, and innovative case stories on
health workforce topics.
Exchanging experiences at the Forum
The Forum provided a platform for policy
dialogue, sharing of research findings, and
exchange of best practices or promising ap-
proaches: a total of 67 sessions (4 plenary
sessions, 20 parallel sessions, and 43 side
sessions) were held during the 5 day pro-
gramme, covering all health workforce is-
sues of relevance to the KD  – AGA. The
Forum structure provided an opportunity
for all constituencies and key players to
organize sessions and have a voice in the
conference, while ensuring the internal co-
herence of the programme. Box 3 contains
more information on the focus of the ple-
nary sessions.
One of the highlights of the 2nd
Global Forum
was the discussion on the progress made in
implementing the KD – AGA. At the global
level, the last few years saw healthcare sys-
tem strengthening rise to greater promi-
nence in the international health policy
discourse, with a greater recognition of the
indispensable role played by the health
workforce. Every major international health
event and process since 2008, from G8 and
Africa Union summits to the adoption of
a WHO Global Code of Practice on the
International Recruitment of Health Per-
sonnel and the launch of the United Na-
tions Secretary-General Global Strategy
Global Health Workforce Alliance
wmj 3 2011 5CS.indd 84 6/21/11 9:32 AM
85
for Women’s and Children’s Health, have
called upon countries and the international
community to strengthen health systems
and accelerate progress on the path to the
Millennium Development Goals, universal
access to HIV prevention, treatment and
care, and universal health coverage. How-
ever, the extent to which this attention was
translating into action by governments,
development partners and other relevant
stakeholders at country level was unclear.
The Alliance therefore undertook a survey
on the key policy and governance elements
that characterize a country’s response to its
health workforce challenges. This survey
was then used to analyse how well countries
are planning and coordinating their health
workforce development including their ef-
forts to develop evidence and information
systems, education and retention strate-
gies, and investment decisions. This semi-
quantitative analysis was complemented by
case stories submitted by countries and or-
ganizations that illustrated through a more
qualitative approach specific aspects in the
implementation of the Agenda for Global
Action in the priority countries.
This analysis, despite some limitations re-
lated to the nature of a rapid survey and
constraints relative to data availability, rep-
resents the first attempt to track progress in
implementing the KD-AGA and provides a
useful snapshot of the human resources for
health policy and the governance situation
in priority countries. The analysis revealed
areas of progress co-existing with others
that require increased attention. Presented
in the first plenary of the Forum, this re-
port served as an instrument for countries,
partners and other relevant stakeholders
to review progress together, to hold one
another accountable, and, by informing
the discussions throughout the rest of the
conference, to renew and strengthen their
commitment to work in partnership to de-
velop and implement sustainable solutions
to the global health workforce crisis. While
the full details of the study are available in
a separate report [13], the general picture
that emerged is that the level of progress in
implementing the KD – AGA is still un-
even, both in relation to different areas of
health workforce development and across
countries. While actions on the ground
in a number of countries may be starting
to make a difference, considerable work
remains to be done to fully maximize the
value of the KD & AGA [14].
Another key highlight of the Forum was
the awards for outstanding health work-
ers and innovative case stories. These two
types of awards honored individuals and
organizations delivering healthcare services,
i.e., Special Recognition Awards for Individu-
als and Awards for Excellence for case stories.
The Special Recognition Awards brought a
human element throughout the forum: the
personal and emotional anecdotes from the
community-level health workers won the
audience’s hearts. Through the Awards for
Excellence, the real experiences of innovative
and sustainable projects were showcased
through ‘case stories’ – real life narratives on
what has worked, where and why, and shar-
ing best practices. At the closing ceremony,
2 individual health workers and 6 case sto-
ries were awarded as the final winners.
The Forum was also designed to carry its
messages out to the wider world through
press coverage, op-eds, and a dedicated
website hosted by the UK Newspaper “The
Guardian” [15]. Moreover, a dedicated ini-
tiative was supported to ensure that health
workforce issues generate even greater in-
terest in the countries where it matters the
most. To this end, ten young journalists
from HRH crisis countries were given the
opportunity to report on the Second Global
Forum on Human Resources for Health.
Exclusively selected from countries facing
severe health worker shortages, the scheme
inspired the journalists to report on health
worker shortages in their national media.
Through exposing the scale and seriousness
of the crisis, this group can stimulate dis-
cussion of country-level progress and chal-
lenges [16].
The way forward: taking
the momentum of the
Second Global Forum
out to the wider world
The conference participants were engaged
through a participatory, consultative pro-
cess in the development of an outcome
statement of the Second Global Forum,
whose main contents are summarized in
this section. Reiterating the validity of the
KD-AGA as an overarching framework for
health workforce development, and recog-
nizing the WHO Global Code of Practice
on International Recruitment of Health
Box 3. Plenary sessions at 2nd
Global Forum on Human Resources for Health.
1. Plenary session 1 “From Kampala to Bangkok: Making progress, Forging solution” dis-
cussed the progress made for the AGA and served as the essential foundation for all
the subsequent sessions.
2. Plenary Session 2 “Have leaders made a difference?: How leadership can show the way
towards MDGs”, examined leadership-related issues confronted when managing
complex and delicate environments, such as: competing priorities, contradictory
purposes and the involvement of various stakeholders.
3. Plenary Session 3 “Professional Leadership and Education for 21st Century” addressed
the key challenges of professional education, shared countries experiences on pro-
viding education to meet the challenges and propose recommendations of health
worker training in the 21st Century.
4. Plenary Session 4 “Making HRH Innovation Work for Strengthening Health Systems”,
reviewed successful lessons learned in HRH innovations for scaling up training and
related country-level experiences.
Global Health Workforce Alliance
wmj 3 2011 5CS.indd 85 6/21/11 9:32 AM
86
Global Health Workforce Alliance
Personnel as a key instrument to foster
HRH collaboration across countries, the
outcome statement was developed on the
basis of the discussions in different sessions
and other major inputs into the Forum,
condensing into a few simple words the key
messages emerging from the Forum.
The outcome statement [17] recognized
that, despite some areas of progress, major
gaps persist:
• The supply of health workers is still in-
sufficient in many countries, particularly
in Africa and complex emergency set-
tings. Shortages should be addressed by
scaling up education and training capac-
ity in order to meet the growing demand
for health personnel.
• Reliable and updated information on the
health workforce is not always present,
hindering the monitoring of progress,and
planning and decision making processes.
Strong national capacity is required in all
countries to regularly collect, analyse and
use data on health workforce availabil-
ity, distribution, employment status, and
migration, to inform policymaking and
management.
While the health workforce challenges were
initially highlighted by making reference
primarily to shortages in terms of absolute
numbers, new benchmarks beyond the den-
sity of physicians, nurses and midwives, will
be required to set appropriate targets toward
which that policy makers can strive. This
will, in turn, help give greater relevance to
other parameters such as geographic distri-
bution, retention, gender balance, minimum
standards, competency frameworks, which
will better reflect the diverse composition of
the health workforce.
Recognizing these gaps, the Forum par-
ticipants agreed that realizing the ambitious
vision of the KD-AGA will require greater
efforts across a number of areas.
Leadership by all state and non‐state actors
is required to strengthen commitment and
focus action on the health workforce. Policy
coherence across sectors is essential, as is
the capability to plan and manage health
workforce development. National health
workforce coordination mechanisms should
be established, or existing ones strength-
ened, to foster synergies among stakehold-
ers and inclusive communities of purpose
where best practices are shared. HRH de-
velopment strategies and budgets should be
linked with national healthcare strategies,
policies and plans.
At the local level, suitable policies and
strategies should be adopted to attract and
retain health workers with an appropriate
skills mix in rural and other under‐served
areas, including the deployment of commu-
nity‐based and mid‐level health providers.
Approaches may include tailoring educa-
tion curricula and practices to work in rural
areas,financial and non‐financial incentives,
regulation, management support and im-
proved career development opportunities.
The quality of care rendered by service
providers should improve through ac-
creditation of health workers and training
institutions and compliance with relevant
national standards and regulation systems.
Performance should be enhanced through
effective supervision, competency‐based
curricula, enabling practice environments
and supportive management practices.
The international migration challenges
should be addressed by putting in place
the necessary regulatory, governance and
information mechanisms envisaged in the
WHO Global Code of Practice on Inter-
national Recruitment of Health Personnel.
An adequate level of financial investment
for health workforce development should
be attained through both domestic and in-
ternational resources. Where allocation of
domestic resources is not sufficient, govern-
ments should increase it, if necessary by re-
laxing macro-economic restrictions, with the
help of International Financial Institutions.
Where the shortfall in resources cannot be
addressed through domestic means alone,
development partners, global health initia-
tives and international agencies share the
collective responsibility to provide predict-
able, long‐term and flexible support, aligned
to country priorities, and national health
plans that allow for investment in pre‐service
education, remuneration and other recurrent
costs for health personnel. Better financial
management mechanisms can foster ac-
countability and improve equity and effi-
ciency of investments made from all sources.
The Forum was an opportunity to review
progress and share experiences. It re-ignited
momentum for health workforce develop-
ment, calling for joint action and renewed
efforts towards the vision that “every person,
whoever they are and wherever they live,has
access to a health worker”[17] .
References
1. Travis P, Bennett S , Haines A, et al. Overcom-
ing health-systems constraints to achieve the
millennium development goals, Lancet 2004;
364:. 900–906.
2. WHO, Working together for health  – World
Health Report 2006
3. Robinson M, Clark P. Forging solutions to
health worker migration. Lancet. 2008 Feb 23;
371(9613):691-3.
4. United Nations. Millennium Development
Goals,; 2000: Available from: http://www.undp.
org/mdg/basics.shtml accessed on March 2nd
2011.
5. The Global Health Workforce Alliance Country
Coordination and Facilitation (CCF) Principles
and process 2010. Available from: http://www.
who.int/workforcealliance/knowledge/resourc-
es/CCF_Principles_Processes_web.pdf accessed
March 2nd
2011
6. Global Health Workforce Alliance. Alliance vi-
sion and mission: Available from: http://www.
who.int/workforcealliance/about/vision_mis-
sion/en/index.html ,accessed on March 2nd
2011
7. GHWA & WHO. The Kampala Declaration
and Agenda for Global Action. GHWA &
WHO. 2008 Available from: http://www.who.
int/workforcealliance/knowledge/resources/
kampala_declaration/en/index.html accessed on
March 2nd
2011
8. Cometto G, Sheikh M. Forging partnerships
to solve the global health workforce crisis and
wmj 3 2011 5CS.indd 86 6/21/11 9:32 AM
87
Socio-Medical-AffairsISRAEL
achieve the health MDGs. World Hosp Health
Serv. 2010;46(3):16-9.
9. United Nations. Access for all to skilled, mo-
tivated and supported health workers  – Back-
ground paper to Global Strategy for Women’s
and Children’s Health; 2010. Available from:
http://www.who.int/pmnch/activities/jointac-
tionplan/20101007_4_skilledworkers.pdf ac-
cessed on March 1st
2011.
10. Global Health Workforce Alliance.Global Expe-
rience of Community Health Workers for Deliv-
ery of Health Related Millennium Development
Goals: A Systematic Review,Country Case Stud-
ies, and Recommendations for Integration into
National Health Systems. GHWA & WHO.
2010 Available from: http://www.who.int/work-
forcealliance/knowledge/resources/chwreport/
en/index.html accessed on March 2nd 2011.
11. World Health Organization. Mid-level health
workers The state of the evidence on pro-
grammes, activities, costs and impact on health
outcomes A literature review; 2008. Geneva,
Switzerland. Available from: http://www.who.
int/hrh/MLHW_review_2008.pdf acessed on
March 1st
2011.
12. WHO. Constraints to Scaling Up Health
Related MDGs: Costing and Financial Gap
analysis, 2009. Available from: http://www.who.
int/choice/publications/d_ScalingUp_MDGs_
WHO_report.pdf accessed on March 2nd 2011
13. Global Health Workforce Alliance (2011).
Reviewing progress, renewing commitments  –
progress report on the Kampala Declaration
and Agenda for Global Action. Geneva, Swit-
zerland. Available from: http://www.who.int/
workforcealliance/forum/2011/progressreport-
launch/en/index.html accessed on February
17th 2011.
14. Sheikh M. Commitment and action to boost
health workforce. Lancet. 2011 Jan 24. [Epub
ahead of print]
15. TheGuardian,2011.GlobalHealthCheck.Avail-
able from: http://www.guardian.co.uk/global-
health-workers; accessed on March 7th
2011
16. Global Health Workforce Alliance 2011. Jour-
nalist fellowship programme. Available from:
http://www.who.int/workforcealliance/fo-
rum/2011/journalist_fellowship/en/index.html
accessed on March 7th 2011
17. Global Health Workforce Alliance 2011. Out-
come statement of the Second Global Forum
on Human Resources for Health. Available
from: http://www.who.int/workforcealliance/
forum/2011/Outcomestatement.pdf accessed
on March 7th 2011.
Dr. Giorgio Cometto, Adviser to the
Executive Director at the Global
Health Workforce Alliance
Dr. Hirotsugu Aiga, Coordinator of the
Global Health Workforce Alliance
Dr. Mubashar Sheikh, Executive Director
of the Global Health Workforce Alliance
E-mail: comettog@who.int
For physicians and allied health care work-
ers across the globe, the experience of job-
related violence is all too common. This is
true to such an extent that many health care
professionals reportedly consider a certain
degree of workplace violence to be an inevi-
table part of the job.
This hazardous dynamic not only endangers
health workers, but can have a devastat-
ing impact on entire health care systems.
Physical and emotional stress and strain as
the result of workplace violence leads to an
increased shortage of health workers due to
sickness, temporary leave of absence and
permanent loss of staff.
With physician shortage already a growing
problem throughout the world, additional
loss of staff due to workplace violence ex-
acerbates the crisis of the public’s restricted
access to health care, itself the inevitable re-
sult of medical manpower shortages.
Workplace Violence Defined
To cite a widely accepted definition of work-
place violence used by the World Health
Organization (WHO), workplace violence
can be described as “the intentional use of
power, threatened or actual, against another
person or against a group, in work-related
circumstances, that either results in or has
a high degree of likelihood of resulting in
injury, death, psychological harm, mal-de-
velopment, or deprivation”[3].
It is important to acknowledge that work-
place violence includes both physical and
non-physical (psychological) violence. Non-
physical violence, including harassment,
threats and verbal abuse,can have severe psy-
chological consequences and must be recog-
nized as having a potential detrimental im-
pact comparable to that of physical violence.
In fact,non-physical violence can have more
severe consequences than physical violence
and can result in numerous health effects
on its victims, including gastrointestinal
disorders and psychosomatic symptoms.
Psychological violence is more prevalent
than physical violence and is widespread
throughout health services.
According to country surveys conducted
by the International Labor Organization
(ILO), patients are the main perpetrators
of physical violence, while staff members
seem to be the main perpetrators of psycho-
logical violence against other professionals.
Yoram Blachar
Violence in the Health Care Sector –
A Global Issue
wmj 3 2011 5CS.indd 87 6/21/11 9:32 AM
88
ISRAELSocio-Medical-Affairs
It is important to highlight, however, the
difficulty of establishing a profile of people
committing acts of workplace violence, and
to acknowledge the risks associated with
generalization and stereotyping in this area.
In the United Kingdom, reports show that
between one quarter and one half of the
National Health Service (NHS) staff report
significant work-related personal distress.
According to country surveys, a majority
of health care workers experienced at least
one incident of physical or psychologi-
cal violence in the previous year: 75.8% in
Bulgaria; 67.2% in Australia; 61% in South
Africa; an average of 48% in Portugal (60%
in health centers and 37% in hospitals); 54%
in Thailand; 46.7% in Brazil [4]. Workplace
violence is a recognized generator of post-
traumatic stress disorder (PTSD) and ac-
cording to surveys, between 40% and 70%
of its victims report significant levels of
PTSD symptoms [3].
Reasons for Escalation
of Violence
In recent years violence in the health sector
has become an increasing problem for a va-
riety of reasons. From a general perspective,
causes of workplace violence have been iden-
tified in three main areas: the organizational
level,the societal level and the individual level.
Causative factors are intricately intertwined
and complex in the way they contribute to
emerging violence, but can broadly be at-
tributed to the accumulation of stress and
tension in health occupations under the
strain of societal problems and the pressure
of health system reform.
Causes of Violence at an Organizational Level
According to the ILO, healthcare workers
are at high risk for experiencing violence at
work, with almost one quarter of all violent
incidents in the workplace occurring in the
health sector [4]. The ILO reports a strong
correlation between workplace violence and
occupations associated with high levels of
stress. The ongoing restructuring of health
care systems,staff shortages,low pay and shift
work are all factors causing health care work-
ers’vulnerability to stress.Work strain has led
to high costs in terms of sickness rates and
loss of staff, increasing the burden on those
who remain.
This correlation between violence and stress
is significant not only in its effect on the
individual worker, but also in determining
the global impact of stress and resulting vio-
lence on health systems and organizations.
The relationship between violence and
stress highlights the importance of address-
ing factors on the organizational level that
may contribute to workplace stress in health
occupations.The implementation of chang-
es to reduce stress will in turn minimize the
elevated costs and compromised efficiency
caused by workplace violence.
Causes of Violence at a Societal Level
It is significant to recognize that the pub-
lic’s conception of the doctor’s role has been
blurred in recent years by the many prob-
lems associated with modern medicine and
health care. Rather than viewing doctors as
public servants dedicated to saving lives and
providing treatment, the physician has be-
come a scapegoat for issues such as rising
health care costs and overcrowding in hos-
pitals and medical institutions. Resulting
misguided anger directed toward doctors
often leads to incidents of violence.
Physicians have been forced to take on the
role of messengers of an inadequate health
system. They must often explain to patients
that the medication they need is not cov-
ered or authorized by their insurance. In
addition, doctors have their hands tied
when it comes to patient complaints of long
waiting times due to inadequate staffing, re-
sources and treatment areas. As health care
costs continue to rise and medical technol-
ogy becomes progressively more expensive,
doctors are becoming increasingly overbur-
dened and at greater risk for workplace vio-
lence due to patient dissatisfaction.
Causes of Violence at an Individual Level
According to the ILO, healthcare workers
tend to rank the personality of patients as
the lead generating factor of violence. Stud-
ies have identified the most common trig-
gers for acts of violence in the health sector
as long waiting times and dissatisfaction with
the treatment provided [1].Studies have sug-
gested that the impatience that accompanies
waiting times may have a cultural element.
When a population experiences a compro-
mised sense of safety and security for an
extended period of time, cultural norms
and patterns of behavior can develop that
trigger a person’s tendency toward violent
conduct. The deterioration of a country’s
economic and/or security situation creates a
circumstance in which physicians are caring
for patients who are affected by the physi-
cal and mental distress of their surrounding
environment.This increased agitation in the
patient population can potentially expose
hospital and community-based physicians
to violent acts in the workplace.
Formulating a Strategy
When establishing a strategy to deal with
workplace violence, it is important to ana-
lyze the origins and risk factors of work-
place stress and violent acts in individual
communities in order to identify resource
allocation priorities and to develop appro-
priate and effective policies.
Based on a variety of studies,it has been rec-
ommended by the ILO and other interna-
tional organizations to take a multi-faceted
approach which integrates interventions at
organizational, societal and individual lev-
els,with a clear focus on preventative action.
Reform in the areas of legislation, security,
data collection, training, environmental fac-
wmj 3 2011 5CS.indd 88 6/21/11 9:32 AM
89
ISRAEL Socio-Medical-Affairs
tors, public awareness and financial incen-
tives is required in order to successfully ad-
dress this issue [1,2].
In addition, collaboration amongst various
stakeholders is essential, including gov-
ernments, National Medical Associations
(NMAs), hospital and general health ser-
vices, management, insurance companies,
trainers and preceptors, researchers and the
police. As the representatives of physicians,
NMAs should not only take an active role in
combating violence, but should encourage
other key factions to act. The commitment
and cooperation of each entity is imperative
to effectively tackle the widespread issue of
workplace violence in the health sector.
Interventions Addressing
Violence in the Health Sector
Based on the analysis of country reports, the
ILO recommends that interventions against
workplace violence in the health sector
should focus on (a) general conditions in so-
ciety and the legal framework; (b) normative
interventions, such as guidelines and man-
agement competencies; and (c) interventions
at the environmental and individual levels [4].
In addition,it is recommended that countries
start by raising awareness of the problem
and building a greater understanding among
health care professionals of the causes and
associated risks of workplace violence.
World Medical Association Recommendations
A statement on violence in the health sector,
currently being proposed for adoption by the
World Medical Association (WMA),makes
detailed strategic recommendations. The
statement urges National Medical Associa-
tions to encourage healthcare institutions to
implement prevention strategies against vio-
lence. Prevention strategies should include,
among other things,the prompt reporting of
violence and a designated plan of action for
incidents of violence.
The statement further recommends that
national priorities and limitations on medi-
cal care be clearly addressed by government
institutions in order to reduce patient dis-
satisfaction. Furthermore, health care ad-
ministrators should adopt a zero-tolerance
attitude to threats and acts of violence.
Various forms of counseling and support
should be provided to staff members who
have been victims of threats of violence and/
or violent assault while at work. When ap-
propriate, the public should be informed
of violent occurrences in order to increase
awareness.
NMAs should lobby for the establishment
of reporting systems that enable health
care workers to report, anonymously and
without reprisal, any threats or incidents
of violence. Such systems should be used
to analyze the effectiveness of prevention
strategies and data should be collected and
recorded.
Law enforcement should give high priority
to acts of violence in the health care sector
and appropriate security measures should
be enforced. A routine violence risk audit
should be implemented to identify high risk
jobs and locations. Hospital staff should
be well-trained in the recognition and an-
ticipation of high risk situations and should
be encouraged by management to remain
vigilant.The cultivation of sound physician-
patient relationships and effective commu-
nication skills should be promoted.
Patient waiting areas should be comfortable
and should provide unrestricted patient ac-
cess to restrooms and necessary facilities.
A system allowing displeased patients to
file complaints and receive appropriate and
timely responses may also serve to reduce
patient anxiety and facilitate a calm and
neutral environment.
The statement also encourages governments
to allocate appropriate funds in order to
implement health care system reforms.
Conclusion
As a global issue, violence in the healthcare
sector continues to be addressed through-
out the world in various ways, and by a
variety of stakeholders. There is no escape
from the recognition that although each
party hopes their efforts will diminish vio-
lence against health professionals; a large-
scale and comprehensive plan is more like-
ly to lead to a significant reduction of this
phenomenon.
Such a plan demands widespread coop-
eration and the active involvement of all
concerned. Parties must work together to
establish prevention plans, which should
be routinely evaluated to assess efficiency
and to identify areas needing improvement.
Sufficient collaboration and the building of
sound policies and frameworks will assist
with the significant reduction of violence in
the health sector.
References
1. Carmi-Iliz, T., Peleg, R., Freud, T., Shvartzman,
P. (2005). Verbal and physical violence towards
hospital- and community-based physicians in
the Negev: an observational study. BMC Health
Service Research, 5(54). doi:  10.1186/1472-
6963-5-54.
2. Derazon, H., Nissimian, S., Yosefy, C., Peled,
R., Hay, E. (1999). Violence in the emergency
department (Hebrew) Harefuah, 137(3-4):95-
101, 95-101. http://www.ima.org.il/harefuah1/
inpage.asp?show=article&nJournalID=94&catI
D=245&artID=1078
3. International Labour Organization (2003). ILO
fact sheet: Workplace violence in the health ser-
vices. Last accessed 28th March 2011. http://
www.ilo.org/public/english/dialogue/sector/pa-
pers/transport/violence.pdf
4. World Health Organization (1995). Prevention
of violence: a public health priority. Last ac-
cessed 28th March 2011. http://www.who.int/
violence_injury_prevention/resources/publica-
tions/en/WHA4925_eng.pdf
Dr. Yoram Blachar,
Israel Medical Association
wmj 3 2011 5CS.indd 89 6/21/11 9:32 AM
90
Suicide is not spoken about openly or eas-
ily, particularly in the medical community.
There is a wall of silence surrounding this
mysterious topic, probably because the pain
is so private and the act so public. But make
no mistake, the suicide death of a physician
is very humbling – whether we are the treat-
ing person, a loved one left behind, a col-
league or friend. John Donne’s wise words
are so apt.“…any man’s death diminishes me,
because I am involved in Mankind…” [1]
According to the Centers for Disease Con-
trol and Prevention (CDC), there is one
death by suicide every 15 minutes in the
United States or 94 suicides per day [2] and
according to the physician depression and
suicide project of the American Founda-
tion for Suicide Prevention, every year 300-
400 physicians kill themselves in America
[3]. In an attempt to address the shock and
disbelief when a physician kills himself or
kills herself, Jamison [4] has written: “No
one who has not been there can compre-
hend the suffering leading up to suicide,nor
can they really understand the suffering of
those left behind in the wake of suicide”.
And Nuland [5] waxes eloquent (literally
and metaphorically) when he explains the
seeming indifference to physician suicide
by other physicians “…for the uninvolved
medical personnel who first view the corpse,
there is another factor to consider, which
hinders compassion.Something about acute
self-destruction is so puzzling to the vibrant
mind of a man or woman whose life is de-
voted to fighting disease that it tends to di-
minish or even obliterate empathy”.
Epidemiology
Suicide is a disproportionately high cause
of mortality in physicians, with depression
as a major risk factor [6]. Schernhammer
and Colditz’s [7] review and meta-analysis
of 25 studies on physician suicide conclud-
ed that the aggregate suicide rate ratio for
male physicians, compared with the general
population, is 1.41:1. For female physicians,
the ratio is 2.27:1. Unlike almost all other
population groups,in which men die by sui-
cide about four times more frequently than
women,physicians have a suicide rate that is
very similar for both men and women.
What do we know about
physician suicide?
There is no one factor that makes some-
one suicidal.The act of suicide is a complex
phenomenon involving some convergence
of genes, psychology and psychosocial
stressors [8]. It is generally felt that 85-
90% of individuals who die by suicide have
been living with some type of psychiatric
illness, whether recognized and treated or
not. Although all physicians have some
basic knowledge about depression and its
treatment, an unknown number die by sui-
cide each year, who seem to ‘fall through
the cracks’. They have never consulted a
mental health professional or received any
treatment by others. Some have treated
Michael F Myers
Physician Suicide and Resilience: Diagnostic,
Therapeutic and Moral Imperatives
This is a revised version of a keynote lecture delivered on October 4, 2010 at the International
Conference on Physician Health in Chicago, IL
Table 1. Profile of a Physician at High Risk for Suicide
Gender Male or female
Age 45+ years old (female); 50+ years old (male)
Race White
Marital Status Divorced, separated, single or currently with marital disruption
Habits
Alcohol or other drug abuse “Workaholic”
Excessive risk taker (especially high-stakes gambler; thrill seeker)
Medical Status
Psychiatric symptoms (especially depression; anxiety)
Physical symptoms (chronic pain; chronic debilitating illness)
Professional
Change in status – threat to status, autonomy, security, financial
stability, recent losses, increased work demands
Access to means
Access to lethal medications
Access to firearms
Reprinted with permission. From Silverman MM. Physicians and Suicide. In Goldman LS,
Myers M, Dickstein LJ, The Handbook of Physician Health. Chicago, IL, American Medical
Association, 2000
Socio-Medical-Affairs UNITED STATES OF AMERICA
wmj 3 2011 5CS.indd 90 6/21/11 9:32 AM
91
themselves. Silverman [9] has concluded
that there are additional factors that make
physicians an at-risk group for suicide
(Table 1).
Reprinted with permission.From Silverman
MM. Physicians and Suicide. In Goldman
LS, Myers M, Dickstein LJ,The Handbook
of Physician Health. Chicago, IL, Ameri-
can Medical Association, 2000
The psychiatric disorders most commonly
implicated in physician suicide are: Major
depressive disorder, bipolar affective disor-
der, alcohol and other drug abuse, anxiety
disorders, and borderline personality disor-
der [9].
In addition to demographic and diagnos-
tic factors that put physicians at risk for
suicide, there are other specifics that play
a role. Table 2 lists some considerations to
keep in mind when trying to understand
suicide in physicians or when conducting a
comprehensive suicide risk assessment in an
ill physician [8].
A few points to remember. There are many
physicians living with a mood disorder and/
or substance dependence who escape at-
tention. Many are untreated or self-treated
and many who are in treatment are under-
treated by their clinicians.The clinician may
have little experience in treating a popula-
tion of sick individuals who are terrified to
be totally honest and who can be cleverly
deceptive. They have not been fully forth-
coming with their treating clinician about
suicidal ideation and a dangerous plan for
self-destruction. In suicidology, one of the
key risk factors in people who die by suicide
is a previous suicide attempt. This does not
always apply to physicians.Doctors who kill
themselves are distinguished by the (rela-
tive) absence of an earlier suicide attempt.
Or if they have attempted suicide before,
when asked, they may lie  – because they
don’t have a trusting relationship yet with
their therapist or they are terrified of being
forced into hospital against their wishes.
How common are suicide
thoughts in physicians?
There is very little research but there are
questionnaire studies that have found clini-
cal depression in residents,including suicid-
al ideation [12,13]. In a study of burnout in
medical students, Dyrbye et al. [14] found
suicidal ideation in 10% of students. In a
study of female university MDs in Sweden
and Italy, 13.7% and 14.3% reported suicid-
al ideation [15]. It is generally believed that
whatever research we do have is probably an
underestimation of the actual frequency of
suicidal thinking in doctors. There is a lot
of shame in reporting thoughts of self-harm
and when a doctor is in treatment, he or
she may fear the consequences of disclos-
ing thoughts of suicide. Some physicians
are comforted by thoughts of suicide which
means that they have a way out, a way of
escaping the pain and that they retain some
measure of control. Being in control and
having control over one’s self is characteris-
tic of many doctors.
Personality traits are significant
Perfectionism is not uncommon in physi-
cians. It is almost impossible to gain en-
trance to medical school without some
measure of thoroughness and attention to
Socio-Medical-AffairsUNITED STATES OF AMERICA
Table 2. Suicide Risk Considerations in Physicians
• Previous history of a depressive episode. This may have occurred in adolescence or young
adulthood,in college or medical school and whether recognized and treated or not,this
is significant information
• Previous suicide attempt. Physician deaths by suicide are distinct from the general public
because of the relative paucity of previous suicide attempts. However, some physicians
have attempted suicide before and survived. Most feel deeply embarrassed and will not
disclose this matter easily to their treating physician
• Family history of mood disorders, including suicide. Many physicians have genetic load-
ing for mood disorders. Suicide can be familial but it is much more complicated than
genetic predisposition
• Professional isolation. This may be long-standing in someone who tends to be a loner,
very private and/or self-contained. But more commonly, professional isolation is the
result of a geographic move or loss of some type (health, family, financial stability).
These individuals lack the supports and the protective factors that militate against
self-destruction [10]
• Lawsuits and medical license investigations. Being sued for malpractice or having com-
plaints made to one’s licensing board about professional competence, safety or ethics
can be one of the most traumatic assaults to a physician’s health and sense of well-
being. Such individuals, especially if alone without actual or perceived supports, are at
risk of self-harm
• Poor treatment adherence. For whatever reason – denial,shame,simple ignorance – some
physicians are not very good patients.They cannot accept the gravity of their illness(es)
and the pressing need for professional help [11].Their symptoms worsen and they lose
hope. If they have an associated unchecked substance abuse problem, they are espe-
cially at risk of killing themselves
• Treatment refractory psychiatric illness. Like patients in general, some physicians suffer
from ‘malignant’ psychiatric disorders that do not respond easily to state-of-the-art
psychiatric treatment. When one is symptomatic for long periods of time or achieves
very short (or increasingly short) periods of remission, demoralization sets in and sui-
cide risk builds
wmj 3 2011 5CS.indd 91 6/21/11 9:32 AM
92
detail. In fact, our work dictates a certain
degree of fastidiousness in order to be accu-
rate, competent and safe. But this tendency
can work against self-acceptance in physi-
cians. When it is hypertrophied, it can be
life threatening. The ill physician is so self-
loathing and unforgiving that he/she can
become dangerously suicidal.
Many physicians have a very high need
for autonomy. They want to set their own
agenda, they eschew intrusion of others and
they argue that they know what is best for
themselves.This stubbornness may preclude
their seeking help from others should they
fall ill or if they do consult someone they
have trouble trusting and fully respecting
the individual as being able to assist them.
Sometimes this is coupled with a rugged
individualism that goes back to their child-
hood. It is their way of going through life.
They hate to bother others or to need others
to help them.
An unknown number of physicians have
personality disorders or traits of one. Phy-
sicians who have a borderline personal-
ity disorder or traits are at risk for suicidal
behavior because of impulsivity, unstable
interpersonal relationships and rejection
sensitivity. Physicians with narcissistic per-
sonality are at risk for suicide (along with
other factors) in the face of overwhelming
loss of prestige, medical license investiga-
tion or public humiliation (for example, be-
ing featured in the media after charges of
medical negligence, medicare fraud, sexual
abuse of patients).
The suicide plans of doctors
There is no systematized research in this
area. However, my experience as a clini-
cian and specialist in physician health has
yielded an important and very concerning
finding. Dangerously suicidal physicians
have often given self-destruction consider-
able thought and invested many hours into
researching suicidal means. They may have
even rehearsed how they would do it. The
intent is serious, the method is highly lethal
and foolproof. This is captured in the state-
ment: “I’m a doctor – I know how to kill
myself – I’m not going to botch it.As a neu-
rosurgeon (or anesthesiologist or intensivist
or emergency physician or thoracic surgeon
or psychiatrist) I have looked after too may
suicidal patients who didn’t die but ended
up permanently disabled after they tried to
kill themselves – not me, I’m going to do it
right”.
What about rational
suicide in physicians?
Physicians who are living with chroni-
cally debilitating medical illnesses are those
most interested in rational suicide. In other
words, they are not suffering from a men-
tal illness that is affecting their judgment.
They are very clear that their medical state
is unbearable and perhaps worsening and
that their decision to die is carefully con-
sidered and best for them. Being physicians
they either know or have investigated what
continuing to live will look like for them
and they know their prognosis.Their family
members, irrespective of their empathy and
compassion and acceptance of their physi-
cian loved one’s clarity about suicide, may
struggle though. All suicides have an after-
math for the family and others left behind,
whether they are rational or not.
What about stigma?
Stigma kills! This scourge is yet to be eradi-
cated in the house of medicine and this
poses one of the greatest challenges for
medicine in the 21st
century. Judgmental,
ignorant, and discriminatory attitudes to-
ward physicians living with mental illness
compound their suffering, increase their
sense of isolation, delay help-seeking, drive
denial of illness and self-treatment, and
heighten the risk for suicide. The stigma
in physicians may be one of two types or
a mixture. Enacted stigma is the stigma
that is embedded in institutional attitudes
toward illness in doctors (noted in ap-
plications for hospital privileges that ask
questions that are not necessary to gauge
competence and safety) and in some medi-
cal licensing bodies (noted in the questions
asked on applications, questions that are
over inclusive and generalized, not about
impairing conditions, psychiatric or other-
wise). Felt or perceived stigma exists in the
suffering physician and is irrational, often
due to his/her mental illness that is affect-
ing cognition and perception. The individ-
ual fears the judgment and scorn of family
and colleagues who actually understand,
they do care and want to help.
Resilience
There are many definitions of resilience but
the following is one of my favorites and
very applicable to the physician population:
“a life force that promotes regeneration and
renewal” and “the ability to confront adver-
sity and still find hope and meaning in life”
[16]. Individuals with good or healthy resil-
ience face their fears and actively cope with
them; have positive emotions and an opti-
mistic attitude toward life; possess a skill set
of cognitive reappraisal, positive reframing
and acceptance; are socially competent and
have social supports in place; and have a
purpose in life, a moral compass, a sense of
meaning and spirituality [17].
How do we reconcile
suicide with resilience?
Most physicians have good-to-excellent re-
silience. Indeed without this, and given the
competition worldwide, they would never
have been accepted into medical school.
Given the seeming paradoxical forces of
embracing life on the one hand and ex-
tinguishing life on the other, how do we
explain suicide in doctors? Do physicians
who kill themselves lack resilience? Do re-
Socio-Medical-Affairs UNITED STATES OF AMERICA
wmj 3 2011 5CS.indd 92 6/21/11 9:32 AM
93
silient physicians never kill themselves? Is
resilience a protective factor against suicide?
Is resilience an absolute and fixed phenom-
enon? Are physicians who seem to be lack-
ing resilience over the long term at risk of
suicide? How does illness affect resilience?
The answers to some of these questions are
obvious, to others more elusive. It is though
probably safe to conclude that virtually all
physicians (with the arguable exception of
rational suicide) who kill themselves are de-
void of resilience when they make that final
and irreversible decision to die.
And yet when I ponder the notions of resil-
ience and suicide in physicians, I feel torn
and anxious. I fear that the notion of phy-
sician resilience will be abused or misap-
propriated, that ailing physicians, who are
sick with any medical or psychiatric disor-
der, may flagellate themselves for not being
more resilient. They do not need this extra
layer of worry on top of their psychological
adjustment to their blighted health. I also
am concerned that physicians who die by
suicide will be judged as they once were –
and still are, in some circles today  – that
they have given up, that they ‘can’t cut the
mustard’, that they lack the ‘muscle’ (or the
‘balls’) to cope with the rigors of a medical
career, that suicide is ‘selfish’and a ‘cop-out’.
As a clinician who has treated scores of
physicians over the years (I treated my first
physician patient during my residency in
1969) and who has lost physician patients
to suicide, I believe that most doctors who
kill themselves are exhausted and demor-
alized, that they hurt terribly inside with
‘psychache’ [18], that their thinking has be-
come constricted, that they (and often their
loved ones) have suffered enough already
and do not deserve the ignominy, hostility
and rejection that sometimes sullies their
demise. Like the attitudes toward doctors
who suffer a mental illness, including sub-
stance abuse, the stigma attached to physi-
cian suicide can be shocking and chilling.
Too many spouses, children and parents of
doctors who died by suicide describe being
unsupported, shunned or judged by their
loved one’s physician colleagues.
Joiner’s [19] conceptualizations of what
drives individuals to kill themselves are
helpful in understanding suicide in physi-
cians. He has described three inner feeling
states:
1. “Perceived burdensomeness”  – a sense
that one is a burden on others.
2. “Failed belongingness” – a sense that one
does not belong to a valued social group.
3. “Learned fearlessness” – the acquired ca-
pability to enact lethal self-injury.
Joiner goes on to explain learned fearless-
ness: “……….the kind of exposure to
pain and fear that people also might learn
through such experiences as mountain
climbing, performing surgery, fighting in
wars or being afflicted with anorexia”. This
sense of fearlessness about death applies to
a segment of physicians who not only fit
into this category but are also very philo-
sophical and accepting of death. Regarding
Joiner’s notion of failed belongingness, it is
certainly true that physicians who become
ill and cannot practice medicine any longer
can feel a sense of loss and estrangement
from their profession. For some doctors, es-
pecially those whose principal identity has
been their work, this can be serious.
A model of suicide
risk assessment
Suicide is an outcome that requires several
things to go wrong all at once. There is no
one cause of suicide and no single type of
suicidal person [20]. Table 3 is a schematic
representation from the above reference.
This is a dynamic flow chart with a bidirec-
tional interaction between any or all listings
under the four headings.
Although this is a universal model that ap-
plies to all suicidal people, it is very help-
ful in assessing the degree of suicidality and
dangerousness risk for ill physicians. Hence,
a physician with the following features
would be deemed very high risk: a family
history of suicide; a major mood disorder
coupled with alcohol abuse, both of which
have been refractory to conventional treat-
ment; recent charges of unwanted sexual
advances by patients and medical students;
media exposure of the latter; a stash of tri-
cyclic antidepressants at home.
The impact of physician suicide
on their families and colleagues
One of first and most common reactions
when a doctor kills himself or kills herself is
Socio-Medical-AffairsUNITED STATES OF AMERICA
Table 3.
Biological Factors
Predisposing
Factors
Proximal Factors
Immediate
Triggers
Familial Risk
Major Psychiatric
Syndromes
Hopelessness
Public Humiliation/
Shame
Serotonergic
Function
Substance Use/
Abuse
Intoxication Access to Weapons
Neurochemical
Regulators
Personality Profile
Impulsiveness
Aggressiveness
Severe Defeat
Demographics Abuse Syndromes
Negative
Expectancy
Major Loss
Pathophysiology
Severe Medical/
Neurological Illness
Severe Chronic
Pain
Worsening
Prognosis
wmj 3 2011 5CS.indd 93 6/21/11 9:32 AM
94
shock. Why? Is there a collective or cultural
denial in the world of medicine, that doctors
don’t die by suicide? Are some physicians
masterful at covering up their illness and
desperation? Are we blind to or neglectful
of our colleagues’ personal interior lives? Are
some deaths of doctors in the 10-15% who
do not have an underlying psychiatric illness
that has made them suicidal? There are no
easy answers to these questions and yet even
when we embrace the idea that the individual
must have been ill – and desperate – disbelief
is still ascendant. Those left behind struggle
with confusion and a flood of unanswerable
questions. Here are some reactions:
The words of Dr. David Satcher (Surgeon
General of the United States 1998-2002):
“Your video is an important effort in get-
ting out a message to destigmatize and de-
scribe this serious problem whose aftermath
is characterized by personal pain, social and
family disruption, and loss of such produc-
tivity and promise” [21].
The words of a doctor’s widow: “We have
this belief that physicians have chosen that
profession to continue and sustain and
protect life……….and when a physician
kills himself or kills herself, it is very, very
confusing…….because it’s almost as if….if
they’re giving up…what’s that mean for the
rest of us?” [22]
The words of a doctor’s daughter [23]: “My
father always said:‘If you’re going to do some-
thing,do it right’.I remember he saw a movie
where a guy killed himself in the shower. He
was very impressed with that.He kept repeat-
ing: ‘He did it there so it’d be easy to clean
up’. But where my father killed himself, the
blood stains are still in the floor boards. It’s
been over 20 years. When I was 17 and he
was 54, my father went up into the attic and
shot himself in the heart. I didn’t cry”.
The words of a doctor’s physician colleague
[24]: “Today I learned that you died and
nothing will ever be the same again. I re-
fused to believe the words I heard, that you
committed suicide. Only terribly depressed
people kill themselves. You weren’t terribly
depressed….but then I learned that, yes, se-
cretly you had been. How could I not know,
not realize?”
The words of a doctor’s patient [25] spo-
ken at the doctor’s funeral: “I’m a patient of
Dr ______. I’m sorry I cannot say: ‘I was
a patient’. I cannot use the past tense. My
doctor saved my life….” As he choked and
struggled for words, he stopped and began
to sob uncontrollably …two attendants
helped him back to his seat.
Some diagnostic, therapeutic
and moral imperatives
How can we lower the incidence of physi-
cian suicide?
Primary prevention
We need to continue to study and delin-
eate risk factors in medical education and
practice. Do we need to change the criteria
used to select medical students? Is there too
much emphasis placed on MCAT scores
and other markers of scholastic achieve-
ment? How standardized or incisive are
medical student applicant personal inter-
views? How sensitive are we to the genetic
and developmental vulnerabilities of our
applicants to medical school and residen-
cy? How much do we accept the elusive
‘woundedness’ of some, in addition to their
intellectual achievements on paper and how
they perform in interviews? How much
should we accommodate pre-existing con-
ditions? We have no acceptable answers to
these questions and what is more, we may
not be asking the right questions anyway in
our attempts to understand suicide in medi-
cal students and physicians.
What about teaching methods in medi-
cal school and residency? We can say with
some evidence that professors and attend-
ing physicians whose teaching style is coer-
cive,shaming or abusive cause psychological
damage to our trainees.At best they become
disillusioned and cynical; at worst, they get
depressed, develop symptoms of post trau-
matic stress disorder,abuse alcohol and oth-
er drugs, and coupled with other issues, may
become despondent and suicidal. Can we –
or should we – change the culture of medi-
cine? I am referring to the ‘macho’mystique,
the normalcy and rewarding of overwork or
workaholism, the ascendancy of intellectu-
alization and rationalism over feeling, com-
passion and humanism, the competition,
the materialism in some sectors, and male
and female sexism in our medical centers
and institutions.
How do we protect ‘good doctors’ who are
used to hard work and self-sacrifice in the
service of their patients, education and
research? Some of these physicians have
amazing resilience, including personal and
family lives that are fulfilling and rich. But
if they are not shielded from taking on more
and more work, especially with diminished
resources, and a needy underserved patient
population, they may burnout and get sick.
How do we use the findings from innumer-
able burnout studies implicating overwork,
loss of locus of control and breakthrough
symptoms of exhaustion, depression and
suicidal ideation? Are the public’s percep-
tions and expectations of their doctors
unrealistic? Many surveys of physicians in
practice have noted their high levels of de-
moralization and an attitude or entitlement
and hostility in many of their patients.
What about medical licensing boards or
hospital credentialing standards that are
outdated, unenlightened and punitive? This
is serious because physicians are terrified of
self-disclosures and discriminatory inves-
tigations. A study of SMB (State Medical
Board) license applications noted that 13
of the 35 SMBs responding indicated that
the diagnosis of a mental illness by itself was
sufficient for sanctioning physicians [26].
This was without any evidence of specifics,
Socio-Medical-Affairs UNITED STATES OF AMERICA
wmj 3 2011 5CS.indd 94 6/21/11 9:32 AM
95
onset, treatment or duration. These same
SMBs also acknowledged that they treat
MDs receiving psychiatric care differently
than those receiving medical care. The au-
thors argue that physicians’ perceptions of
this apparent discrimination likely plays a
role in delayed or absent help seeking for
symptoms of a mental illness. These same
physicians end up with no treatment or
treat themselves, both of which put them at
risk of worsening morbidity and, in some,
possible mortality.
Finally, is there anything that can be done
about a litigious climate of lawsuits and soar-
ing costs? This drives an ethos of defensive
medical practice, anxiety about being sued
and in many doctors, a risk of developing a
clinical illness as a result of this assault [27].
Secondary prevention
Physicians continue to kill themselves  –
world wide – despite research on morbidity
and mortality in doctors that has been avail-
able in the scientific literature for decades. In
fact, the amount of evidence-based research
is increasing.So given the burgeoning studies
on burnout, substance use and abuse and de-
pression in medical students and residents –
in many countries – we must redouble our
efforts toward promoting self-care and mak-
ing sure that these findings are known to
clerkship and training directors, deans and
associate deans, department chairs, chiefs of
staff and so forth.We cannot be complacent;
we cannot turn the other cheek and say that
doctors don’t take their lives in this medical
center or this community.
We need to find ways of identifying trainees
and licensed physicians at risk by education
and inculcating an accepting attitude in their
peers, employers and caregivers. Outreach
needs to be early, timely, invitational, wel-
coming, comprehensive and kind. We must
ensure that diagnostic and treatment servic-
es for trainees are available and advertised –
free or sliding scale, confidential and geo-
graphically accessible. We all must continue
to fight stigma both in our words and deeds,
by speaking openly and discretely about our
own personal struggles if so inclined and by
supporting our colleagues when ill.
Loved ones of medical students and phy-
sicians are key players in physician health
who have a vested interest and should be a
‘protective’factor. Not only are they the best
ones to provide collaborative information
but they need to be our allies in a compre-
hensive treatment plan and caretakers must
make themselves available to them. Too
many ill physicians are receiving treatment
for serious mental illnesses and their fam-
ily members are totally excluded from their
care. Therapists need to understand that
many physicians are masters at deception
and what they choose to disclose in their
treatment sessions may be devoid of the
dysfunction and symptomatic behavior at
home. Grieving spouses, parents and chil-
dren of doctors who have killed themselves
have an enormous amount to teach us about
bearing witness to the anguish and pain of
their loved one prior to his or her death.
Self-treatment must stop by ensuring that
all physicians have primary care physicians
who are interested and skilled at treating
ailing doctors. This is no easy task. Count-
less physicians have trouble turning over
their health care to someone else, even
when those individuals are available. They
do not trust easily.And too many physicians
who treat other physicians do not give them
the same kind of diagnostic and therapeutic
excellence that they give to their non-physi-
cian patients.They make too many assump-
tions and avoid embarrassing questions and
physical examination steps that compromise
the care.Unfortunately,the doctor patient is
put at risk of worsening illness because of
missed diagnoses or inadequate treatment.
All medical communities  – world wide  –
need diagnostic and treatment resources
(similar to state and physician health pro-
grams in the USA and Canada). They have
been established to meet the needs of col-
leagues at risk from the stress of practicing
medicine. The science is first rate and there
is always a continuing education compo-
nent to keep the knowledge base up-to-
date and to make sure that compassion and
treatment eclipse punitive and discrimina-
tory attitudes toward ill physicians.
Tertiary prevention
In addition to primary care doctors who
treat physician patients with respect and
thoroughness, we need specialists in addic-
tion medicine, psychiatrists and other men-
tal health professionals with expertise in
physician health, specialists in occupational
health and rehabilitation, psychopharma-
cologists, and good (and affordable) treat-
ment resources. Physicians, like patients in
general, may suffer from difficult-to-treat
mood disorders, often comorbid with sub-
stance abuse, that require expertise that may
be beyond the generalist. Indeed, it may be
dangerous for a solo mental health profes-
sional to try to be all things to his/her pa-
tient. It is best to share the responsibility
with others to ensure that your patient is
getting the best care.
We need to continue research on (and edu-
cate about) recurrent and chronic illnesses
in physicians that need treatment and
monitoring. This is not common knowl-
edge. Given how doctors abhor illness in
themselves and each other, there is a naïve
attitude in some dimensions of the medical
community that all that the ill doctor needs
to do is go away for awhile, get treated and
come back with 100% functioning. This is
often not the case and there are many doc-
tors who report feeling chided by employers
and colleagues if they are not able to take
on the same case load or medical respon-
sibilities that they assumed before they fell
ill. We need return-to-work plans and pro-
grams that accommodate partially disabled
doctors. And most important, disability
insurance needs modernizing and fairness.
Socio-Medical-AffairsUNITED STATES OF AMERICA
wmj 3 2011 5CS.indd 95 6/21/11 9:32 AM
96
Some doctors make need to remain on par-
tial disability indefinitely.
Colleagues of physicians who are away on
extended medical leave need to keep in
touch with them via email, cards, phone
calls and visits (if the person is up for being
visited). Ill physicians often feel bereft of
the day-to-day medical world and can feel
out of the loop quickly. Worse is that they
feel rejected as no longer ‘part of the club’
if they do not hear from their work mates.
Gestures of missing them will aid healing
and lift spirits. Families need support for
their central role in keeping their physician
loved one well – or in some cases of refrac-
tory illness – alive.
Some moral imperatives
Advocacy is part of being a physician and
this has never been more applicable than in
physician health and wellness. I urge you to
fight the stigma associated with suicide  –
whether it is for the deceased physician or
his/her family. Speak out, write letters and
papers, volunteer, invite experts to give in-
service training, lectures, seminars and so
forth. Educate staff and faculty about this
unique type of loss. Present cases at M &
M rounds, critical incident debriefing af-
ter a suicide. The American Foundation
for Suicide Prevention has a Suicide Data
Bank Project and a Physician Depression
and Suicide Prevention project.
When a medical colleague dies by sui-
cide there is a lot that you can do, both
for yourself and for others who knew the
physician. There are diverse reactions in the
colleagues of deceased physicians [8, page
201]. Mourning is to be expected and this
includes the full range of emotions and
thoughts that people experience when they
lose a colleague or friend to death. But it
may be more intense and confusing because
your colleague died by suicide. Some be-
reaved physicians feel anxious after a death
like this. They may feel personally vulner-
able, that they themselves have felt stressed
with their work or have been depressed.
An inner question may haunt them: “Am I
prone to suicide?” or they may fear the sui-
cide of another colleague of the deceased
doctor.This is called ‘contagion fear’.
Some doctors feel guilty and may blame
themselves. They are upset that they didn’t
do more to prevent the doctor’s suicide. Or
they castigate themselves for missing clues
that the person may have been giving. If
they didn’t reach out to the doctor and ask
how they were feeling or try to steer him/
her for care, they may be wracked with feel-
ings of regret. Some grieving doctors will
blame other physicians in their group or
medical setting for not doing more, for fail-
ing the deceased physician.
Anger and rage at the deceased physician
are not uncommon. Very primitive and
seemingly irrational emotions and state-
ments accompany deaths by suicide. Some
doctors will blame the suicide victim for
‘giving up’ or being ‘selfish’, that they didn’t
accept treatment or give it enough time or
that they were thinking only of themselves
and not the many people they have left
behind. These same individuals will accuse
the deceased of abandoning his/her fam-
ily, friends, medical mates and patients. In
some communities where there is a shortage
of physicians, the doctors may feel ‘dumped
on’, that they now have to look after the
dead doctor’s patients. “And what do I tell
them?” may be a question that they don’t
know how to answer. Other physicians feel
judged by a colleague’s suicide,that our pub-
lic perception of being invincible is tainted
by the doctor’s death. This is rooted in the
history of suicide through the ages, that it is
a blight, a shameful death.
And finally some doctors carry on as if the
physician simply died of natural causes.
Their manner and stance is business as usu-
al. Inwardly such physicians may be angry,
hurt or devastated but they keep their feel-
ings to themselves.
Organizational initiatives
The American Medical Association is in
the process of forming an expert panel to
address risk factors for suicide in medical
students and physicians with representation
from medical educators, mental health pro-
fessionals and suicidologists. The National
Action Alliance for Suicide Prevention was
launched on September 10, 2010 (World
Suicide Prevention Day). Its focus is three-
fold: 1) Updating and advancing the Na-
tional Strategy for Suicide Prevention from
2001; 2) Development of effective public
awareness and social marketing campaigns,
including targeted messages for specific
segments of the population that can change
attitudes and norms and reduce suicidal be-
haviors; and 3) Advancing suicide preven-
tion among high-risk groups.Physicians are
considered a high-risk group.
Research imperatives
and the future
We need evidence-based research on mood
disorders and other Axis I illnesses in physi-
cians, especially substance use disorders.This
must include treatment outcome research
and not just psychopharmacological studies.
Another area that needs updating is research
into the suicide risk factors in physicians.
We know a lot but much of our data are
old. Given the mosaic of physicians practic-
ing medicine currently, there must be factors
that have not been studied.Early outreach by
the treatment team or a suicide social agency
to the families of doctors who have killed
themselves must happen routinely. Currently
it is hit and miss.There is a compelling need
for postvention studies on families and col-
leagues of doctors who have died by suicide.
This will include psychological autopsies
on doctors who have killed themselves, in-
formation that is sorely lacking. Our great-
est challenge will be grieving families and
medical colleagues of the deceased physician.
Accurate studies are impeded by the privacy
rights of families, their protective denial and
Socio-Medical-Affairs UNITED STATES OF AMERICA
wmj 3 2011 5CS.indd 96 6/21/11 9:32 AM
97
shame,and the collusive secrecy of the medi-
cal community and the family.
Finally, qualitative research on medical stu-
dents and physicians who have made suicide
attempts (especially near lethal and aborted
attempts) and who did not die is overdue.
The narrative recording of their memories,
thoughts, thought process and feelings with
the goal of understanding the ‘why’ and the
‘how’of their decision to die will yield criti-
cal information, information that can assist
in prevention, especially early intervention.
This research will be helpful not just for the
person him/herself in treatment planning
but by extension, very helpful in identifying
which physicians might be at risk of suicide.
Conclusion
I can think of no more fitting way to con-
clude this paper than the way I ended my
lecture, that is, with quotes from the eulo-
gies of the son and daughter of a physician
who ended his life in 2010.
From his son:
In the last few months,he entered his deepest and
darkest struggle. I called him every day, offering
advice, a different perspective, another way to
look at things, suggestions of how to feel better.
And he was so thankful – he loved my advice
and suggestions. I felt like we were making
progress.
But in the end, I didn’t realize how deep his
pain was. And despite all he told me, he was
in a worse place than I or anyone else realized.
He’s gone now, and his pain has subsided. Yet
his loss will live with me every
day for the rest of my life. I had nearly 40
amazing, wonderful years with him.
Right now, the hole in my heart is big – it will
heal, but a large and permanent scar will re-
main.
From his daughter, a physician herself:
As many of you know already, my father took
his own life. As I told the children, he had a
sickness in his brain, and because of the sickness
he made a bad decision. And unfortunately, it’s
not one that can be undone. All of these things
we see in him, he couldn’t see in himself. We
tried so hard to tell him, to reassure him. But he
couldn’t hear it. His brain just wasn’t function-
ing properly.
……………As doctors, we feel as though we
are supposed to be perfect in some way, and my
father embodied that sentiment. He wanted to
be perfect, and when he saw that he wasn’t, he
couldn’t tolerate it.
Depression is a real disease. I don’t know why
or how it happens, but it does. And to honor my
father we can bring it out from the shadows and
remove the shame.There is NO shame in depres-
sion. I want everyone in this room to hear that,
and I want my father to hear that, wherever he
is. You will always remain a smart, hardwork-
ing,lovable mensch,regardless of what you were
suffering. Your family loves you so much.
References
1. Donne J. Meditation Xvii.
2. Centers for Disease Control and Prevention.
Suicide Facts at a Glance. Summer 2010. www.
cdc.gov
3. American Foundation for Suicide Prevention.
www.afsp.org
4. Jamison KR. Forward.Touched by suicide: hope
and healing after loss. Myers MF and Fine C.
New York, Gotham/Penguin, 2006.
5. Nuland SB.How we die: reflections on life’s final
chapter.New York,Alfred A Knopf,1994,p 151.
6. Center C, Davis M, Detre T et al. Confronting
depression and suicide in physicians: a consensus
statement. JAMA 2003;289:3161-3166.
7. Schernhammer ES, Colditz GA. Suicide rates
among physicians: a quantitative and gender
assessment (meta-analysis). Am J Psychiatry
2004;161:2295-2302.
8. Myers MF, Gabbard GO. The physician as pa-
tient: a clinical handbook for mental health pro-
fessionals. Washington, DC. American Psychi-
atric Publishing, Inc, 2008, p 186.
9. Silverman MM. Physicians and suicide. In: The
handbook of physician health. Edited by Gold-
man LS, Myers M, Dickstein LJ. Chicago, IL,
American Medical Association, 2000.
10. American Psychiatric Association: Practice
guidelines for the treatment of psychiatric disor-
ders: Assessment and treatment of patients with
suicidal behaviors, compendium 2004. Wash-
ington, DC, American Psychiatric Association,
2004, pp 835-1027.
11. Jamison KR. Night falls fast: understanding sui-
cide. New York, Knopf, 1999, p 268.
12. Hendrie HC, Clair DK, Brittain HM et al. A
study of anxiety/depressive symptoms of medical
students, house staff, and their spouses/partners.
J Nerv Ment Dis 1990;178:204-207.
13. Hsu K, Marshall V. Prevalence of depression
and distress in a large sample of Canadian
residents, interns and fellows. Am J Psychiatry
1987;144:1561-1566.
14. Dyrbye LN,Thomas MR,Massie FS et al.Burn-
out and suicidal ideation among US medical stu-
dents. Ann Int Med 2008;149:334-341.
15. Fridner A, Belkic K, Marini M et al. Survey
on recent suicidal ideation among female uni-
versity hospital physicians in Sweden and Italy
(The HOUPE Study): cross-sectional asso-
ciations with work stressors. Gender Medicine
2009;6:314-328.
16. Deveson A. Resilience. Allen & Unwin. Sydney,
2003, pp 161, 267.
17. Feder A, Nestler EJ, Charney DS. Psychobiol-
ogy and molecular genetics of resilience. Nature
Reviews Neuroscience 2009;10:446-457.
18. Shneidman ES. Suicide as psychache. J Nerv
Ment Dis 1993;181:145-147.
19. Joiner TE. Why people die by suicide. Cam-
bridge, MA, Harvard University Press, 2005.
20. AAS suicide risk assessment 2009.DVD.Amer-
ican Association of Suicidology, Washington,
DC.
21. From the commentary of When Physicians Com-
mit Suicide: Reflections of Those They Leave Behind.
Videotape produced by MF Myers 1998.
22. Fine C. Excerpt from When Physicians Commit
Suicide: Reflections of Those They Leave Behind.
Videotape produced by MF Myers 1998.
23. Heckel S.Unspeakable.Documentary film.2009.
24. Middleton JL. Today I’m grieving a physician
suicide. Ann Fam Med 2008;6:267-269.
25. Myers MF. Physician suicides leave many vic-
tims in their wake. Winnipeg Free Press, Octo-
ber 1, 2006.
26. Hendin H, Reynolds C, Fox D et al. Licens-
ing and physician mental health: problems
and possibilities. J Med Licensure and Discipline
2007;93:1-6.
27. Charles S. Physician litigation stress resource
center. www.physicianlitigationstress.org
Michael F Myers, MD;
Professor of Clinical Psychiatry;
Vice-Chair Education and Director
of Training Department of
Psychiatry & Behavioral Sciences
SUNY Downstate Medical Center
E-mail: michael.myers@downstate.edu
Socio-Medical-AffairsUNITED STATES OF AMERICA
wmj 3 2011 5CS.indd 97 6/21/11 9:32 AM
98
Genome Sequencing AUSTRALIA
Introduction
Human genetic disorders fall into three cat-
egories: (1) Somatic cell defects, (2) Men-
delian genetic disorders and (3) Complex
genetic disorders (Table 1). The latter two
involve the germline and so are heritable.
Our understanding of pathogenesis in the
somatic cell defects is still mostly research-
in-progress. These usually involve sporadic
cancers. The Mendelian genetic disorders
are well characterised at the molecular level
although for many the underlying causative
genes remain to be found. In contrast, we
know very little of the complex genetic dis-
orders apart from the assumption that they
are caused by gene-gene, gene-environment
or gene-environmental-epigenetic inter-
actions [1]. Our understanding of genetic
disorders took a major step forward when
these were better understood at the DNA
level.
The molecular (DNA) era for medical
genetics started in 1953 with the de-
scription of DNA’s double helix structure
by J. Watson, F. Crick, M. Wilkins and
R. Franklin. For this discovery the first
three were awarded the 1962 Nobel Prize
in Physiology or Medicine (Rosalind
Franklin had died by then). Subsequently,
there were many more discoveries involv-
ing DNA and RNA which provided a
new molecular understanding of genetic
diseases and how they arose through mu-
tations in genes. From this came better
ways to investigate and then detect these
disorders by DNA testing. A number of
important developments then occurred
leading to the potential for sequencing
the whole human genome as a compo-
nent of patient care. These developments
included:
• In the 1970s, DNA genetic testing start-
ed with a method called Southern blot-
ting. This was cumbersome, dangerous
(radioactivity and carcinogenic chemicals
were used) and took a few weeks to get a
result. The method would predominantly
detect deletions in genes which represent
the less common disease-causing muta-
tions.
• DNA mutation testing took a major step
forward when methods were devised to
sequence segments of DNA. This meant
the four nucleotide bases – adenine (A),
thymine (T), guanine (G) and cytosine
(C) making up a segment of DNA could
be identified. Point mutations (single base
changes) which comprise the usual cause
for a genetic disease were now identifi-
able. For work on developing DNA se-
quencing W. Gilbert and F. Sanger were
awarded a Nobel Prize in 1980.
• The next significant advance in genet-
ic DNA testing was the discovery of
a technique called PCR (Polymerase
Chain Reaction) in 1985. For this,
K. Mullis was awarded the 1993 Nobel
Prize in Chemistry. PCR had a signifi-
cant impact on DNA genetic testing in
medicine as well as forensic science, in-
dustry and many different research ap-
plications because it is a technique that
allows a segment of DNA to be ampli-
fied hundreds to millions of times. In
effect, PCR allows a portion of DNA
to be cloned so it can be more easily
manipulated or characterised. The latter
has direct applications for DNA genetic
testing.
• The last important development oc-
curred during 1991 to 2000. This was
the Human Genome Project the pri-
mary goal of which was to DNA se-
quence the first human genome. At the
time, it was proposed that the Human
Genome Project once completed would
provide a new paradigm for medical
care through a thorough understand-
ing of human genetic disorders. Un-
fortunately, this has not turned out to
be the case because, if anything, the
Human Genome Project has produced
more questions than answers. For ex-
ample, at the beginning of the Human
Genome Project it was generally be-
lieved that humans had about 150,000
genes coding for proteins. Today, the
estimated number of these genes is
closer to 20,000 [1]. This is a puzzle
because the mouse also has 20,000
protein-coding genes (as has the pinot
noir grape!). So, what is the difference
between humans and the mouse? The
Human Genome Project has opened
up some new areas of understanding
about the human genome, particularly
the role of non-coding (nc) RNA spe-
cies [2].
• An important by-product of the Human
Genome Project was technology devel-
opment and this enabled better and fast-
er ways to sequence the human genome.
Ron Trent
Whole Genome Sequencing – a New
Paradigm for Clinical Care?
Based in part on a presentation to the World Medical Association – Australian
Medical Association meeting Medical Leadership: The View from Down Under
on 5 April 2011 in Sydney.
wmj 3 2011 5CS.indd 98 6/21/11 9:32 AM
99
Genome SequencingAUSTRALIA
DNA sequencing
DNA sequencing is considered the “gold
standard” for mutation detection because it
will allow single base changes to be iden-
tified and characterised. DNA sequencing
is of little use for detecting unknown dele-
tions. During the early days of the Human
Genome Project, DNA sequencing became
increasingly more automated so that larger
read lengths were possible, for example, 800
base pairs (bp) became a standard length for
a sequence trace (Figure 1). Genes would be
larger than this but by incorporating PCR
and new approaches to sequencing, it was
possible to break the gene into segments and
each was sequenced separately. For example,
all exons and the exon-intron boundaries
of a gene could be sequenced individually
rather than the whole gene because it was in
these regions that the more serious disease-
causing mutations were likely to be found.
As the Human Genome Project progressed
so did the technologies for DNA sequenc-
ing until the unthinkable was proposed – a
whole genome sequence that would cost
around $1,000. This needs to be put into
the context that the first human genome
reported in 2003 was estimated to have
cost around $3 billion to complete. From
2003 to 2011, the costs for a whole human
genome have plummeted, and today com-
mercial companies can complete a whole
genome sequence for about $4,000. The
$1,000 target is not far away [3]. By com-
parison, DNA sequencing for two common
breast cancer genes (BRCA1, BRCA2) costs
around $2,000–$3,000, yet all 20,000 hu-
man genes including these two cancer genes
can be sequenced for $4,000 and likely to
be $1,000 in the next 12 months. There is
also talk that the technology will continue
to improve and $100 for a whole genome
sequence is achievable!
65 81
GCTAAGCTGGAATAAAATCCACTTACCTGT
G
C
T
A
Figure 1. DNA sequencing. Automated se-
quencing is now possible and it uses sophisticat-
ed analytic platforms as well as bioinformatics
tools to identify changes in the DNA sequence.
The four bases are distinguished by lines.
Changes in the DNA sequence compared to
normal would signify a mutation or a neutral
change which is called a DNA polymorphism.
The significance of DNA changes (collectively
called DNA variants) requires analysis by
software and reference to DNA databases and
the literature. In a number of cases (up to 15%
when the breast cancer genes are sequenced),
the significance of variants cannot be estab-
lished and these are known as VUS (variants
of unknown significance). Not surprisingly, the
likelihood of VUS changes in a whole genome
sequence will be significantly greater.
Whole genome sequencing in humans only
became realistic when new analytic plat-
forms and alternative strategies were de-
veloped.These are called NG DNA sequenc-
ing (NG  – next generation) or massively
parallel DNA sequencing. Basically, the NG
DNA sequencing strategies rely on smaller
DNA fragment being sequenced (100 bp)
rather than the 800 bp described above
with conventional DNA sequencing which
is also called Sanger sequencing. But to get
around the smaller fragments sequenced,
the technology allows a larger number of
overlapping fragments to be generated  –
up to x30 coverage can be achieved. The
smaller but overlapping fragments repre-
sent a giant jigsaw puzzle made up of two
copies of 3.3 billion combinations of A, T,
G and C.These are put together in the cor-
Table 1. Classification of genetic disorders
Somatic cell defects Mendelian genetic defects Complex genetic disorders
Acquired Inherited as autosomal dominant,
recessive or X linked disorders
G x G, G x E, G x G x E,
G x EPI, G x E x EPI and
other combinations pos-
sible1
No implications for
family members
Quantifiable risks for family
members
Familial risk can be appar-
ent but not quantifiable in
the individual case
Cancer tissue testing
current model dem-
onstrating recurring
mutations in key
pathways
Strong high penetrance genes
involved. Can draw family tree
tracing disease
Twin studies confirm heri-
tability
DNA genetic testing
helps in guiding
therapies. Whole ge-
netic sequencing is a
promising approach
for new classification
based on molecular
signatures
DNA genetic testing useful for
multiple applications from plan-
ning pregnancies, screening popu-
lations to predicting development
of disease well into the future
Whole genome sequencing being
used to find new causative genes
DNA genetic testing not
useful in clinical care.
Whole genome sequencing
now being explored to iden-
tify the G and EPI compo-
nents in pathogenesis
1
G = genetic; E = environmental; EPI = epigenetic effects.
wmj 3 2011 5CS.indd 99 6/21/11 9:32 AM
100
rect order through bioinformatics i.e. soft-
ware tools.
Applications: NG DNA
sequencing and somatic cell
genetic testing of solid tumours
Researchers quickly saw the potential ben-
efits of NG DNA sequencing and many
whole genome sequencing projects devel-
oped. These followed the Human Genome
Project format which involved ambitious
research questions being asked, and the
answers sought by sophisticated DNA se-
quencing and bioinformatics strategies. An
example would be the International Can-
cer Genome Consortium (ICGC) [4]. This
started in 2009 and its aim is to sequence 50
of the most important human cancers us-
ing DNA taken from the tumours. This is
called somatic cell DNA genetic testing be-
cause the mutations are only present in the
somatic cells and so not passed on through
the germline to other family members.
The ICGC is a multinational endeavour
and is only in its early stages but already
interesting molecular signatures for differ-
ent tumours are being identified.These mo-
lecular signatures have shown that a limited
number of DNA mutations are necessary
for tumour formation and the changes are
not tumour specific [5]. Hence, the tradi-
tional histological or immunophenotypic
classifications can be complemented with
changes in DNA. Perhaps the molecular
changes (signatures) will eventually prove
more useful than the traditional ways for
establishing diagnosis and prognosis.
Already the molecular signatures associated
with tumours are being used to guide treat-
ment with examples including: (1) Breast
cancer and amplification of the HER2 gene.
Chemotherapy with the humanised mono-
clonal antibody Herceptin in this tumour is
more effective when it has multiple copies
of the HER2 gene. This type of approach is
called personalised medicine because it pro-
vides additional DNA based information
allowing better selection of drugs for any
particular individual [6]. Ultimately, select-
ing the best drug for a tumour will save
health dollars and, in the case of Herceptin,
will avoid exposing patients to potential
serious side effects if this drug is unlikely
to be effective. (2) Treatment of metastatic
colon with another humanised monoclonal an-
tibody cetuximab. In this particular example,
the KRAS gene needs to be in its normal
(wild type) configuration for the drug to be
effective. (3) Treatment of metastatic mela-
noma with an experimental drug PLX4032.
This is showing very promising results in
what is otherwise a difficult malignancy to
treat. For optimal response to PLX4032 the
BRAF gene must have the V600E mutation.
The successes seen with somatic cell DNA
testing in tumours would suggest that whole
genome sequences of all tumours will soon
be part of the routine clinical and patholog-
ical workup of a tumour so that treatment
decisions can be based on molecular signa-
tures.In other words,there will no longer be
a drug for treating lung or colon cancer.This
will be replaced by a drug(s) that target(s)
a genetic cancer-causing mutation(s) which
might be found in either or both of the
mentioned cancers. Combination chemo-
therapy regimens would follow the same
rationale but target multiple mutations.
Germline whole
genome sequencing
DNA changes in the germline have been
inherited from our parents and can be
passed on to our children. Hence, germline
DNA genetic testing is different to the so-
matic cell testing described above because it
involves other members of the family who
share our genes (and so will share our risks).
Germline DNA testing also can be used for
predictive genetic testing since we are born
with these mutations. Therefore, looking
for an inherited mutation in an asymptom-
atic individual will allow a prediction that
sometime into the future a disease might
arise. An example is Huntington disease
(HD) predictive DNA testing. HD is an
autosomal dominant disorder so children of
an affected parent have a 1 in 2 (50%) risk of
inheriting a mutated HTT gene that causes
HD. Onset of this invariably fatal neurode-
generative disorder is in the fourth or fifth
decade and penetrance of the HD DNA
mutation is 100%. This means that anyone
with the right mutation in the HD gene
will invariably develop this disorder un-
less they die from some other cause before
they reach the age for HD development.
The HD mutation can be looked for at any
time in life (or in utero or preimplantation
genetic diagnosis) to predict an individual’s
risk, i.e., no risk or 100% risk for develop-
ing HD. A similar test is available for breast
cancer when there is a strong family history
or other clinical features to suggest a sig-
nificant genetic component [7]. However,
in this case the penetrance for mutations in
the BRCA1 or BRCA2 genes is not 100%
but between 60% and 80% depending on a
number of factors.
Another area of interest in DNA genetic
testing is pharmacogenetics which allows
individual’s genetic predisposition to drug
therapies to be predicted based on their
genetic makeup [8]. It is proposed that the
“right drug for the right person” might be
achievable by taking into consideration
the metabolising status of the patient and
in this way select a more appropriate drug
dosage to optimise efficacy or alternatively
reduce the dose to avoid side effects that oc-
cur because the individual’s genes involved
in metabolising a drug into the inactive
forms are less effective.
The delivery of personalised medicine will
require more genetic DNA testing to assist
in clinical decision making. This is now be-
ing undertaken using single gene tests that
look at one or two genes. Apart from the
costs (illustrated above with the BRCA1
and BRCA2 example), it is time consuming
Genome Sequencing AUSTRALIA
wmj 3 2011 5CS.indd 100 6/21/11 9:32 AM
101
and potentially inefficient because the same
test might be repeated a number of times
if results are not readily available. Since
changes are in the germline,they will always
remain the same and so repeat tests are un-
necessary. In contrast, a once-in-a-lifetime
whole genome sequence can be interrogated
on a regular basis depending on the clinical
context. Provided it can be safely stored and
protected to avoid any potential ethical legal
social issues (ELSI) see below, it needs only
be tested once. Since the actual test cost is
likely to be cheap, it becomes a cost effec-
tive and efficient way to move forward the
personalised medicine agenda.
Some future clinical
research directions for whole
genome sequencing
A global health problem is obesity and there
are many traditional public health based
strategies to prevent this growing epidemic.
To date the results are disappointing and so
other strategies are being considered. Can
genetics help? So far the answer is no be-
cause only very rare forms of obesity are of
the Mendelian type and so caused by muta-
tions in single genes. The great majority of
cases are considered to represent a complex
genetic disorder with genes, environment
and epigenetic effects all potentially play-
ing a role. Nevertheless, twin studies which
compare obesity in monozygotic twins
(who share essentially the same DNA) ver-
sus dizygotic twins (who share 50% of their
DNA) suggest that the heritability factor in
obesity is considerable at around 81% [9]. A
lot of work is now being undertaken to find
the genes implicated in obesity (including
knowledge from whole genome sequences)
and from this use DNA testing approaches
to identify those particularly at risk, and
new targets for drug therapies.
Another interesting development in obe-
sity is the potential that our gut flora might
be involved in pathogenesis. This has come
from metagenomics studies of the hu-
man gut flora (metagenomics refers to the
characterisation by DNA sequencing of all
microorganisms in an uncultured environ-
ment). Humans have two types of DNA
(nuclear DNA and mitochrondrial DNA)
but so far we have ignored the DNA con-
tent in our gut flora which is estimated to be
x100 our nuclear DNA and comprises over
500 species of bacteria [10]. Some early re-
search studies are also suggesting that the
metagenome is different in the obese and
non-obese individual, and perhaps more in-
triguingly that germ free mice given a gut
metagenome from an obese or non-obese
mouse will revert to the phenotype of the
donor mouse [11]. It will be interesting to
see how this story progresses particularly
the implication that diet may influence
obesity via the metagenome and not calorie
intake alone.
Challenges ahead for
whole genome sequencing
in clinical care
There is little doubt that whole genome se-
quencing has made important contributions
to research proposals and will continue to
do so in this area. However, there are many
challenges ahead before the whole genome
sequence can be effectively integrated into
clinical care.These include:
Translation of research findings: As a 2008
news feature in Nature suggested, cross-
ing over from basic medical research into
its clinical applications is like “crossing
the valley of death” [12]. There is planning
needed to ensure that the beneficial research
applications from whole genome sequenc-
ing can be rapidly moved into clinical care.
Some jurisdictions are now asking the right
questions about the clinical implications for
whole genome sequencing and clinical ser-
vice delivery.A few clinical studies are being
described where whole genome sequencing
is used to inform clinical decision making
[13]. However, more research is needed, as
are new clinical decision-making tools to
link genome data with appropriate inter-
ventions.
Bioinformatics: Few would dispute that
whole genome sequencing will become
faster,cheaper and easier to deliver.The road
block today and for sometime into the fu-
ture will remain our superficial understand-
ing of the genome. The Introduction im-
plied that knowledge of the 20,000 human
protein-coding genes will not be enough,
and as these only occupy about 1–2% of the
genome there remain vast regions that will
be sequenced but their significance will re-
main uncertain. However, just as we found
with the development of the computer, the
software programs available for in silico
analysis of whole genome sequences will
only get faster and more sophisticated. As
our understanding of the human genome
improves, it will be possible to go back to
an individual’s whole genome sequence and
reinterrogate it to update the information.
Engaging health professionals and the com-
munity: Health professionals, particularly
the general (family) practitioner, are already
under considerable pressure maintaining
continuing education requirements for ar-
eas of practice with which they have some
familiarity and meet regularly. While whole
genome sequencing can be predicted to play
a key role in our understanding of disease
risks and new therapies, it will take some
time for familiarisation with this technol-
ogy, particularly what it can or cannot do.
In contrast, members of the community are
constantly being exposed to media reports
of gene X or Y being able to predict disease
or human traits such as sporting prowess.
Curiosity is followed by Internet searches.
As such, the community seems to be more
engaged in the genetics developments than
the health professionals and this may be-
come problematic if the doctor-patient
relationship does not develop to take on
board the influence that the Internet can
play in patient care.
Genome SequencingAUSTRALIA
wmj 3 2011 5CS.indd 101 6/21/11 9:32 AM
102
Genome Sequencing AUSTRALIA
Addressing ELSI (ethical, legal, social issues):
Inappropriate use of genetic information
can cause problems related to privacy, dis-
crimination, stigmatisation or loss of self-
esteem.These are issues that are under active
consideration for the more straightforward
DNA genetic testing but will be more com-
plex with whole genome sequencing. On
the other hand, the modern generation
seems to be fairly relaxed about privacy or
confidentiality issues as evidenced by social
media that are increasingly popular. So the
implications for ELSI and whole genome
sequencing may differ depending on how
comfortable is the individual with the elec-
tronic media as whole genome sequencing
and interpretations of the results will rely
entirely on eHealth capability. While per-
sonalised medicine has many attributes, it
is the antithesis of public health medicine
since the individual is the focus. This will
mean that new therapies developed through
personalised medicine will not be available
(or subsidised depending on the health
system involved) for all in the community.
Other broader considerations include the
potential for unnecessary hype to be coun-
terproductive because promises will not be
delivered, and the influence of the growing
direct-to-consumer DNA testing market
discussed next.
Direct-to-consumer (DTC) DNA testing: The
provision of DNA testing direct to the pub-
lic and bypassing the health professional
has grown rapidly since the mid 2000s
when there were only a handful of these
services. The DTC marketplace has moved
ahead with little oversight by the regulators
but this has recently changed following two
adverse reports from the US Government
Accountability Office and a paper in Nature
suggesting that the actual DNA test was re-
liability undertaken by two of the leading
US DTC DNA testing companies but the
interpretation of the risks for some serious
medical disorders could differ [14]. While
the DTC model is attractive to consumers
who are increasingly turning to the Inter-
net for services, it advertises and sells DNA
genetic tests as a commodity. Promises
made about the implications of DNA ge-
netic testing for health, well-being and even
longevity are qualified by caveats. Services
based offshore cannot for practical purposes
be regulated or held accountable. Today,
companies are moving to DTC whole ge-
nome sequencing.
Rural, remote and the disadvantaged: As
personalised medicine starts to impact on
health care,it is expected that those living in
rare or remote regions or are disadvantaged
will have access to the same genetic devel-
opments including whole genome sequenc-
ing. The DTC DNA testing market has
already shown that DNA is portable and
can be flown from one country to another
so distances and transportation are not an
issue. Costs as indicated above are coming
down and hopefully will not become a limi-
tation. Interpretation of the whole genome
sequence will continue to be a barrier but
this should not relate to distance or isolation
with expected developments in eHealth.
Conclusions
Whole genome DNA sequencing repre-
sents rapidly evolving technology that will
impact on clinical care particularly in rela-
tion to personalised medicine. There is still
a long way to go for the development of
bioinformatics programs to enable a better
understanding of what the DNA sequence
is saying in terms of an individual’s health
or risk for disease development. Neverthe-
less,software development will progress and
the whole genome sequence will become a
component of routine care or public health
medicine in terms of disease prevention or
identification of risks. New therapeutics
based on underlying molecular signature of
disease will be developed. For this technol-
ogy to be effectively integrated into clini-
cal care will require engaged and educated
health professionals and members of the
public. The challenges are considerable but
the potential benefits are enormous.
References
1. Trent RJ. Molecular medicine. 3rd
edition. San
Diego, Elsevier, 2005. 4th
edition in 2012.
2. Taft RJ, Pang KC, Mercer TR, Dinger M, Mat-
tick JS.Non-coding RNAs: regulators of disease.
Journal of Pathology 2009;220:126-139.
3. Mardis ER. A decade’s perspective on DNA se-
quencing technology. Nature 2011;470:198-203.
4. International Cancer Genome Consortium
www.icgc.org/
5. Hanahan D, Weinberg RA. Hallmarks of can-
cer: the next generation. Cell 2011;144:646-674.
6. US President’s Council of Advisors on Science
and Technology report 2008 on pesonalized
medicine. www.whitehouse.gov/files/docu-
ments/ostp/PCAST/pcast_report_v2.pdf
7. US National Cancer Institute  – Genetics of
Breast and Ovarian Cancer www.cancer.gov/
cancertopics/pdq/genetics/breast-and-ovarian/
HealthProfessional/page1
8. Wang L, McLeod HL,Weinshilboum RM. Ge-
netics and drug response. New England Journal
of Medicine 2011;364:1144-1153.
9. Bell CG, Walley AJ, Froguel P. The genet-
ics of human obesity. Nature Reviews Genetics
2005;6:221-234.
10. Carroll IM, Threadgill DW, Threadgill DS.
The gastrointestinal microbiome: a malleable,
third genome of mammals. Mammalian Genome
2009;20:395-403.
11. Ley RE. Obesity and the human microbiome.
Current Opinion in Gastroenterology 2010;26:5-
11.
12. Butler D. Crossing the Valley of Death.
2008;453:840-842.
13. Ashley EA, Butte AJ, Wheeler MT, Chen R,
Klein TE, Dewey FE et al. Clinical assessment
incorporating a personal genome. Lancet 2010;
375:1525-1535.
14. Ng PC, Murray SS, Levy S, Venter JC. An
agenda for personalized medicine. Nature
2009;461:724-726.
Ronald JA Trent, Professor of
Medical Molecular Genetics
Sydney Medical School, University of Sydney;
Head of the Department of
Molecular & Clinical Genetics
Royal Prince Alfred Hospital, Australia
E-mail: ronald.trent@sydney.edu.a
wmj 3 2011 5CS.indd 102 6/21/11 9:32 AM
103
VaccinesUNITED STATES OF AMERICA
The statistics show that too many children
and youth become injured, maimed and
die in variety of accidents, too many get ill
with infectious diseases, preventable by a
healthier lifestyle, hygiene and vaccinations,
and lack the available, reachable health care.
It is important to emphasize the improved
health effects of vaccines not only on the
health of children but also on the popula-
tion of the country. Vaccinations not only
have prevented the spread but have led to
the eradication of some diseases. Discus-
sions about vaccination have surfaced since
the population have forgotten and not seen
the death, the crippling effects of poliomy-
elitis, the physical and emotional effects,
even death resulting from measles, rubella,
mumps and varicella, not to mention the
multitude of other side effects. The primary
care physicians are fully aware and trained
in the preventive medical approaches, in-
cluding vaccination.
The beginning of vaccination practices in
the middle of the last century was the most
important historical progress in the field of
child health. It is unfortunate that currently
this medical achievement has evoked major
discussions and created complex problems.
The vaccine-preventable diseases are not
as prevalent, yet common in the countries
where the vaccination practices are poor
and inadequate and most of the popula-
tion fails to receive the recommended doses
of vaccines. We must always be aware that
the infectious diseases are only one airline
flight away. Repeatedly there are cases of
a traveler-transmitted disease, as most re-
cently happened in California, USA where
a traveler with measles was in contact with
839 and infected 11 persons. Anyone, who
has not been vaccinated or partially so, is at
risk.In 1999 measles outbreak 3000 became
ill and 3 died. In 2006, in USA mid states
there were 4000 cases of mumps and across
the USA repeatedly off and on, there are re-
ported cases of pertussis and other vaccine-
preventable infections. Each person should
be aware, parents and doctors included, of
the pain, fear, and sadness, the financial
expenses, lost time of work that the infec-
tious disease can create. Scientifically, it has
been proven that the crowd immunity of the
vaccinated does not necessarily protect the
unvaccinated unless the surrounding im-
munity is greater than 95%. The hope on
crowd immunity does give false security. In
addition,one must be aware that the tetanus
vaccine only protects the one who is vacci-
nated. Tetanus is not a person-to-person
transmissible infection as the bacillus is
present in soil and the animal excreta.
There are 2.5 million children under the age
of 5, who die of vaccine-preventable dis-
eases. The goal of vaccines is to prevent the
disease, yet the ultimate goal is to exhaust
the disease. In order to reach these goals, it
is imperative that the physicians and health
care workers prioritize to vaccinate infants,
children, adolescents and adults. It is im-
perative that all receive preventive vaccines.
In 1977, the global eradication of smallpox
was achieved. Since 1991, poliomyelitis has
vanished in the USA.Since 2000,the ongo-
ing measles transmission has disappeared.
2004 signaled the end of the appearance
of rubella cases and associated congenital
rubella syndrome in the USA. Since the
mumps vaccine was instituted in1968, the
2007 statistics show the decrease of mumps
by 99%. In the USA, the extensive vacci-
nation program has accomplished the case
disappearance of diphtheria in 2007.
The pertussis vaccine was developed in the
1920s. In the 2007 statistics, it is evident
that pertussis illness has decreased by 93%,
unfortunately, still yearly 20 to 40 infants
under 3 months of age, who have not been
vaccinated, die. The research has proven
that the immunity against pertussis wanes
gradually and therefore a booster TDAP
is required at 11 years of age and recom-
mended to expectant mothers to decrease
the potential transmissibility of pertussis to
their newborns. Every year in the USA ap-
proximately 30 become ill with tetanus and
one of ten die. The statistics of 2009 con-
firm the great success of vaccines in the de-
crease of illness and death.Since 1985 when
HIB (Haemophilus influenzae bacterial vac-
cine) was licensed, the USA 2007 statistics
confirmed the 99% decrease of H. influen-
zae illness. The health benefits are evident
with the pneumococcal vaccine. Every year
>40,000 become ill with severe pneumo-
coccal-induced infections and >4,400 die.
This vaccine is designed to protect against
severe infections, not for ear infection. To
protect against a greater spectrum of pneu-
mococcal-induced infections, the original
PCV (pneumococcal conjugate vaccine) of
7 serotypes has been modified to consist of
13 serotypes.
The pneumococcal 23 vaccine is recom-
mended for those ill with chronic ailments.
The USA statistics confirm yearly occur-
rence of 78,000 new hepatitis B cases, of
whom 5000 die. The annual occurrence of
Zaiga Alksne Phillips
Overview of the Vaccines in Preventing
Infectious Diseases
wmj 3 2011 5CS.indd 103 6/21/11 9:32 AM
104
UNITED STATES OF AMERICAVaccines
hepatitis A is 20,000 cases, of whom more
than 100 die. Varicella occurrence is 67,400,
of whom 54 die of the complications. Me-
ningococcal infection occurrence is re-
ported as 1000 to 3000, ofwhom 125 die.
In contrast, every year there are 31 million
ill with influenza and 30,000 cases of death
are reported. Keeping statistics is essential
to report the cases of disease occurrence,
the deaths and the benefits derived from
preventive vaccinations in the surveillance
of infectious diseases and health care of the
country. BCG vaccine is not used in the
USA since,based on the statistical evidence,
tuberculosis is not widespread, yet cases of
occurrence must and are reported to Public
Health Departments and the contacts are
identified and tested.
Reviewing the above disease statistics and
the benefits reached from vaccinations, it
is difficult to understand why the parents
would refuse to vaccinate their children.
The infectious diseases mentioned above
are widespread in countries where there is
lack of governmental support for health,
lack of understanding, presence of fear, ex-
isting misinformation and lack of science-
based information. Unfortunately, many of
the health workers, including physicians
and nurses, are themselves misinformed
and lacking the knowledge and the belief
in the benefits of the immunizations that
would also reduce the nation’s health care
expenses.The effects are far reaching, affect-
ing not only the nation’s health but leading
to increased health expenses.
It is important how the vaccination practices
have developed in countries where health is
considered a priority. In the USA, as an ex-
ample dependent on the laws and the health
care in each of the 50 states, the number of
the vaccinated vary to some degree, yet on
average 9 out of every 10 children and ado-
lescents are fully vaccinated. It is of extreme
importance to document the cost and com-
pare the nation’s vaccination expenses with
the expenses incurred from the care of the
ill with infectious, vaccine-preventable dis-
eases, the crippled and mentally affected by
the disease, the public measures to curb the
spread of disease and loss of the work force
of the ill. The cost of infectious diseases is
major not only to the government, but also
to the country’s health and well-being.
Ongoing research and discoveries in im-
munology, molecular biology and genetics
have enhanced the development of new
vaccines and improved the safety of famil-
iar vaccines. The science requests the expert
and common scientific balance between
the risks, side effects and the effectiveness
of vaccines. It takes years of extensive test-
ing to carefully evaluate the new, improved
or combined vaccine and only then when
there is a guarantee in safety and effective-
ness, the newly licensed vaccine is to find
its place in the pharmaceutical marketplace.
The newly licensed vaccine continues to be
closely monitored. Its use, the reactions, if
any, are well documented. The specific field
trial analysis is continuous. On the rare oc-
casions, when the vaccine has been received
by many, the rare side effects may be ob-
served. Increased cases of intersection were
noted to be associated with the initial – li-
censed in August 1998 – tetravalent rotavi-
rus oral vaccine (RotoShield). This product
was voluntarily withdrawn from market
in October 1999 and the production was
stopped. In February 2006, a live oral hu-
man-bovine heptavalent rotavirus vaccine
(RotaTeq) was licensed and in April 2008, a
live oral human attenuated rotavirus vaccine
(Rotarix) was licensed. It is imperative that
the physicians and health care workers have
the newest vaccine/vaccination information
and are updated with information regarding
changes and safety.
In a cooperative relationship with FDA
(Food and Drug Administration) and the
Centers for Disease Control and Prevention
in the USA, vaccine safety is monitored by
VAERS (Vaccine Adverse Event Report-
ing System). VAERS is tasked to collect
and systemically review adverse effects and
reactions that may be associated with vacci-
nations, assess the risks and pinpoint which
vaccine, constituent or substrate has pro-
duced the unexpected symptoms. With set
specific guidelines in place, the physicians
are obligated to provide VAERS with the
information regarding the vaccine side ef-
fects or post vaccine symptoms.The vaccine
administered is tracked by the production
and date numbers, the date administered,
the person administering and parental/
guardian consent. All of the above must be
carefully recorded. The National Vaccine
Injury Compensation Program is involved
in evaluation and may as needed set up
compensation for vaccine-related injuries.
vPhysicians and health workers should be
expecting questions from the parents and
be able to provide the answers and the ex-
planations regarding vaccination, safety,
efficacy and risks involved. Some parents
have strong personal and religious beliefs
regarding vaccination. The following ques-
tions need to be understood: do patients
lack timely and up-to-date information; are
there organizations and persons that op-
pose immunization by personal, religious
and alternative medicine principles that
are not scientifically based; is there a lack
of trust in modern medicine, health care
and physicians; and is there a lack of un-
derstanding the disease, the complications
from infections, the risks and the inabil-
ity to value the protection from disease or
diseases that combined vaccines provide?
When one sees parental opposition to vac-
cinations, it is imperative to clarify whether
the fears and reasons for concern are regard-
ing one or all vaccines. A recent nationwide
USA questionnaire involving 1552 parents
revealed the following: 90% of parents feel
that the vaccines are a great way to protect
from certain infectious diseases, 54% are
concerned about post vaccination reac-
tions, 25% believe that there is a vaccina-
tion and autism association and 11.5% have
refused one to several vaccines for variety of
reasons. It is a known fact that the current
vaccines since 1930 are the most researched
and scientifically evaluated medication that
wmj 3 2011 5CS.indd 104 6/21/11 9:32 AM
105
UNITED STATES OF AMERICA Vaccines
is introduced into the human body, yet it is
acknowledged that vaccines are not 100%
safe. Fever and vaccine site reactions remain
the most common side effects. Severe com-
plications occur in approximately 1 out of
1,000,000 vaccinations.
As progress continues with the develop-
ment of new vaccines, such as those against
rotavirus and HPV (human papillomavi-
rus), it is imperative to accept the fact that
certain vaccine recipients do not develop
the expected full immunity, yet vaccines
are effective in 90% of cases. The parents
frequently express the following concerns
and questions whether there are too many
vaccines given at one time, together or at
too young an age. Is the immune system
of an infant able to handle so many vac-
cines? What about the development of
autism, allergy, diabetes and other autoim-
mune diseases in future? Is it scientifically
proven that the immune system of an infant
is well developed and can process multiple
antigens and respond well with immunity?
Current vaccines in the United States pro-
tect against 16 infectious diseases, and pro-
vide the effect of 177 individual antigens.
To compare, the vaccinations in 1980 were
protective against 8 diseases, yet there were
3041 varied antigens. Here we see the prog-
ress in the refinement of the vaccine bio-
logical ingredients. Combination vaccines
have lead to more efficient and complete
vaccination practice, less stress to the pa-
tient and time loss to parents. Psychiatrists
have noted that children who have received
their vaccinations in combined forms and at
the commended time intervals perform bet-
ter on psychological testing.
During the past 10 years,attention has been
directed towards the debunked association
between vaccines and autism. It started
with Andrew Wakefield’s 1998 publica-
tion in “Lancet”.The extensive research that
followed failed to prove any association of
vaccines and the minute amount of mercury
that is used as preservative in vaccines. The
Wakefield study has now been discredited
and proven to be fraudulent. Fortunately,
the diagnostic studies and the identification
of autism have progressed and currently ap-
proximately 1 of every 100 children in the
USA has been diagnosed to have an autism
spectrum disorder. Genetic and environ-
mental association is implied.
The antivaccination campaigns are very ac-
tive. The news and the internet information
that parents access provide scary unrealistic
stories of vaccine-associated complications.
It is very important to achieve a greater trust
in medical area and in the individual physi-
cian. It is important to have an open dis-
cussion about vaccines, the side effects and
the benefits of infectious disease prevention.
The physician must be well informed, be-
lieve in immunizations, be a good listener
and understand the parental needs and con-
cerns.It is imperative that we protect our-
selves, the population of Latvia, and the fu-
ture of Latvia against preventable diseases.
The infants, children and the adolescents
will travel and are traveling anywhere in
world and the health worker responsibilities
are to keep the nation healthy.
References
1. AAP Red Book: 2009 report of the Committee
on Infectious Diseases.
2. Smith PJ, Kennedy AM, Wooten K, Gust DA,
3. Pickering LK. Association between health care
providers’ influence on parents who have con-
cerns about vaccine safety and vaccination cov-
erage.
4. Pediatrics 2006; 118.Benin AL, Wisner-Scher
DJ, Colson E, Shapiro ED,
5. Holmboe ES. Qualitative analysis of mothers’
decision-making about vaccines for infants: the
impotence of trust. Pediatrics 2006; 117.
6. Dunn J. Immunization myths: “The facts about
FAQs”.
7. Department of Pediatrics & Preventive Health-
Group Health Vaccine Advisory Committee,
Washington State Department of Health, Au-
gust 2010.
8. Recommendations for identification and pub-
lic health management of persons with chronic
hepatitis B virus infection. CDC Morbidity and
Mortality Weekly Report. September 19, 2008.
9. CDC Online Source for Credible Health Infor-
mation cdcinfo@cdc.gov
10. Vaccine safety  – frequently asked questions
about multiple vaccinations and the immune
system.
11. CDC Online Source for Credible Health Infor-
mation cdcinfo@cdc.gov
12. Vaccine safety – sudden infant death syndrome
(SIDS) and vaccines.
13. Syncope after vaccination  – in United States,
January 2005–July 2007.
14. MMWR 2008;57(17):457-460.
15. Duchin JS. Communications with patients and
parents about immunizations. Public Health,
Seattle & King County, Washington State Bul-
letin, King County Medical Association, Sep-
tember/October 2010.
16. Kaplan SL. Partnering with parents to achieve
immunization goals. Summer 2009 PRI health
care solutions.
17. Centers for Disease Control and Prevention
(CDC) www.cdc.gov/vaccines/hcp.htmNational
Network for Immunization Information www.
immunizationinfo.org
18. Children’s Hospital of Philadelphia Vaccine
Education Center
19. www.chop.edu/service/vaccine-education-cent-
er/home.htm/
20. Immunization Action Coalition www.immu-
nize.org
Zaiga Alksne Phillips,
F.A.A.P. USA
wmj 3 2011 5CS.indd 105 6/21/11 9:32 AM
106
Health and Enviroment Alliance
There is a growing global consensus regard-
ing a missing key element of cancer pre-
vention. Increasing numbers of experts are
convinced that the current focus on lifestyle
changes related to alcohol and tobacco use,as
well as maintaining healthy diet and exercise
habits, needs to shift to emphasize govern-
ment action to reduce harmful environmen-
tal exposures. A particular concern is the
involuntary and unwitting exposures of indi-
viduals to harmful chemicals in everyday life.
The World Medical Association has added
its weight to the argument in its “Statement
on Environmental Degradation and Sound
Management of Chemicals”agreed in 2010.
It highlights the growing use of industrial
chemicals and pesticides and calls for a
more comprehensive approach to the safe
regulation of harmful domestic and indus-
trial substances [1].
The European Union is a recognised global
leader on addressing this issue. It responded
to the scientific evidence on human expo-
sure to carcinogens with the introduction of
legislation pertaining to chemical manage-
ment known as REACH in 2007 [1], and
later with legislation that supported a range
of changes on pesticide use [2].
The US scientific community is echoing the
EU’s concerns. In May of 2010, recommen-
dations by the US President’s Cancer Panel
Report called for stronger government regu-
lations for better cancer prevention [3]. An
article in the New England Journal of Med-
icine in March, 2011 has gone a step further
by identifying environmental carcinogens as
the number one threat to cancer prevention..
The article states: “The most valuable ap-
proaches to reducing cancer morbidity and
mortality lie in avoiding the introduction of
carcinogenic agents into the environment
and eliminating exposure to carcinogenic
agents that are already there”[5].
The World Health Organization’s specialist
agency on cancer, IARC, noted the contri-
bution of exposure to synthetic chemicals as
a contributor to cancer in a report in 2008.
It recognised as important “the potential
cancer burden from exposure to hundreds of
probable and possible human carcinogens
that have been identified and from thou-
sands of new chemicals that have not been
tested for their cancer potential” [6]. A re-
cent WHO review of evidence on the bur-
den of disease from chemicals has conclud-
ed that, “the known burden of chemicals is
considerable” and supports further action.
“Effective public health interventions are
known to manage chemicals and limit their
public health impacts and should be imple-
mented at national and international levels”
[7]. Discussions on the required response
were set to be addressed at a WHO meeting
in Spain in March 2011 on “Environmental
and occupational determinations of cancer,
Interventions for primary prevention”. A
collective “call to action” for the primary
prevention of cancer was planned [8].
What is primary prevention?
Primary “environmental and occupa-
tional”prevention could be defined as re-
ducing involuntary exposure to harmful
chemicals by removing carcinogens and
other chemicals linked to cancer, such as
endocrine disruptors, from the environ-
ment and the workplace. It is separate
from early detection (such as breast can-
cer screening) and would benefit from
being distinctly separated into systemic
versus individual lifestyle measures.
Are chemicals to blame?
As noted in the WMA Statement [1], In
recent decades there has been a rapid in-
crease in the use of pesticides and fertilis-
ers in agriculture and synthetic chemicals
in consumer and industrial goods. During
the same 50 years, the incidence of cancer
has increased, despite some reductions in
mortality rates due to improved treatments.
Currently, in Europe, one in two men and
one in three women is or will be affected
by cancer. The increase in cancer incidence
can only be partly attributed to an aging
Lisette van Vliet
Why Cancer Prevention isn’t Working Well
Enough
Genon Jensen
wmj 3 2011 5CS.indd 106 6/21/11 9:32 AM
107
Health and Enviroment Alliance
European population. The rest – around
52% for men and 55% for women – must be
attributed to environmental causes, which
include the natural environment, work and
indoor environments, food and so on.
Tobacco and alcohol cannot be blamed for
the rising rates because their use is stagnat-
ing or declining in many European coun-
tries. This is confirmed in some European
countries by the decrease in cancers that are
mostly related to these substances, such as
lung and oesophageal cancer. On the other
hand, breast cancer rates have reached epi-
demic proportions in Europe.In France,the
number of cases of breast cancer increased
by an astronomical 97% between 1980 and
2000,according to a French national agency
report [9]. New figures in the UK show that
one in eight British women can expect a
breast cancer diagnosis during her lifetime.
Cancer amongst children is also rising. The
average childhood cancer incidence has in-
creased by 1% per year in Europe over the
past 30 years. [10]. This worrying trend
underlines again that risk factors associ-
ated with life style, such as alcohol, tobacco,
diet and exercise, cannot be relied upon too
heavily in cancer prevention.
Unsafe exposure
In the European Union, approximately
100,000 different synthetic chemicals are
on the market, around 30,000 of which are
produced at volumes of more than one ton
per year.
In the last 25 years, less than 3% of these
chemicals (1% in terms of volume) has
been thoroughly analysed for their haz-
ardous properties and given a formal and
quantified assessment of their toxicologi-
cal and eco-toxicological risks. The recent
EU REACH and pesticides legislation are
important steps in the right direction but
implementation is very slow and many car-
cinogens and endocrine disrupting chemi-
cals remain in everyday use.
If breast cancer rates are to be brought
down, prohibitions and phase-outs of car-
cinogenic and endocrine-disrupting chemi-
cals, such as Bisphenol A, need to be expe-
dited to reduce everyday exposure.Professor
Andreas Kortenkamp, a leading scientist on
several EU research projects on endocrine
disrupting chemicals and a signatory of the
Prague Declaration on endocrine disrupting
chemicals, says that the risk of breast cancer
will not be reduced until preventable causes,
particularly exposure to chemicals, are ad-
dressed [11]. Childhood cancer incidence
may best be addressed by reducing exposure
to pesticides. A comprehensive review of
the human health effects of pesticides by
the Ontario College of Family Physicians
highlights several studies implicating pesti-
cides as a cause of non-Hodgkin’s lympho-
ma and leukaemia in children [12].
For all cancers, the potential impact of
primary prevention is probably underesti-
mated rather than overestimated. Although
evidence of some direct correlation exists,
little is known at the present time about
the risks from combinations of exposures
at levels found in the environment. Equally,
too little is known about exposures during
critical time windows of development or in
susceptible populations. As a report from
the IARC pointed out: «Cancers may have
multiple causes, so that environmental fac-
tors may contribute to cancers that are at-
tributed to occupational or lifestyle factors»
[4].
What needs to happen?
Countries around the world can draw on
the findings of the US President’s Panel on
Cancer, which include the call for a remov-
al of carcinogens, mutagens, chemicals tox-
ic to reproduction and endocrine disruptors
from the market. HEAL and others at the
World Health Organization meeting in
Asturias, Spain in March, 2011 intended
to present the President’s Panel recom-
mendations for inclusion in a planned call
to action for the primary prevention of
cancer, which is also likely to address the
more traditional exposures, such as passive
smoking and radon. The recommendations
of the US President’s Panel will also be use-
ful to WMA members who are taking the
Statement on Environmental Degradation
to the national level.
If major inroads into cancer prevention
are to be made, national and EU cancer
prevention plans should take into account
these recommendations on primary envi-
ronmental prevention, including carcino-
gen and EDC exposure. The EU’s “Action
against Cancer: European Partnership”
does not currently address environmental
and occupational dimension in preventing
cancer. In an effort to correct this omission,
HEAL has brought together 21 groups, in-
cluding the European Respiratory Society
and the International Society of Doctors
for the Environment, to support the need
to address primary environmental and oc-
cupational carcinogen exposure in cancer
prevention [13]. Spain has already incor-
porated environmental prevention into its
national plan. It needs to be ensured that
the national cancer action plans that all EU
member states are preparing or implement-
ing also highlight the environmental di-
mension.
WMA national leaders can also help make
information materials available for fellow
doctors. US doctors have already produced
a fact sheet on “Cancer and the Environ-
ment: What health care providers should
know”[14]. A training programme for doc-
tors themselves is planned in Paris immedi-
ately after the Paris Appeal 2011 meeting
on children’s health and the environment in
April [15]. The role of WMA, doctors and
scientists in supporting this shift in cancer
prevention cannot be underestimated. Gov-
ernments need the support of public health
arguments from medical professionals to
make the necessary policy changes that will
bring major reductions in cancer incidence
worldwide.
wmj 3 2011 5CS.indd 107 6/21/11 9:32 AM
108
AUSTRALIASocio-Medical-Affairs
The Health and Environment Alliance aims to
raise awareness of how environmental protec-
tion improves health. It achieves this by cre-
ating opportunities for better representation
of citizens’ and health experts’ perspectives in
the environment and health-related European
policy-making. Our membership includes a
diverse network of more than 65 citizens’, pa-
tients’, women’s, health professionals’ and envi-
ronmental organisations across Europe and has
a strong track record in increasing public and
expert engagement in both EU debates and the
decision-making process.
References
1. What will new EU chemicals legislation deliver
for public health? Leaflet from HEAL’s Chemi-
cals Health Monitor project, available in seven
languages at http://www.chemicalshealthmoni-
tor.org/spip.php?article148
2. A review of the role pesticides play in some can-
cers, CHEMTrust, includes section on regula-
tory issues, www.chemtrust.org.uk
3. IARC World Cancer Report 2008 http://www.
iarc.fr/en/Publications/PDFs-online/World-
Cancer-Report
4. World Medical Association, Statement on En-
vironmental Degradation and Sound Manage-
ment of Chemicals, www.wma.net
5. Pruss-Uston A et al, Knowns and unknowns on
burden of disease from chemicals; a systematic
review, Environmental Health, Environmental
Health 2011, 10:9doi:10.1186/1476-069X-10-9
http://www.ncbi.nlm.nih.gov/pmc/articles/
PMC3037292/
6. WHO meeting entitled “Environmental and
occupational determinations of cancer, Inter-
ventions for primary prevention”, March 2010
http://www.who.int/phe/news/events/interna-
tional_conference/en/index.html
7. US President’s Cancer Panel: “Reducing the
Environmental Causes of Cancer” (200 pages);
Article: Environmentally caused cancers are
‘grossly underestimated’ and ‘needlessly dev-
astate American lives’ available at http://www.
environmentalhealthnews.org/ehs/news/presi-
dents-cancer-panel.
8. Christiani DC, Combating Environmen-
tal Causes of Cancer, New Engl J Med 2011;
364:791-793March 3, 2011
9. “Evolution de l’incidence et de la mortalité de
1978 2000”, 2004, Institut de veille sanitaire
(InVs), France.
10. IARC study shows increasing cancer rates in
children in Europe, Press release 155, 10 De-
cember 2004.
11. Scientists deliver wake-up call: “Reduce chemi-
cal exposure to reduce breast cancer”, HEAL,
CHEMTrust press release, 2 April 2008.
12. Sanborn, M et al, Systematic Review of Pesti-
cide Human Health Effects, Ontario College of
Family Physicians, Toronto. Available at: www.
ocfp.on.ca
13. Letter to the European Parliament’s Environ-
ment committee, on Commission Communica-
tion on Action against Cancer: European Part-
nership, 7 April 2010, see
14. http://www.env-health.org/a/3554
15. Fact sheet, Cancer and the Environment, What
health care providers should know. http://www.
psr.org/assets/pdfs/cancer-and-the-environ-
ment.pdf
16.Intensive Course in Environmental
Medicine, 14-16 April 2011, Paris, France,
www.artac.info
Useful documents
1. WMA Statement on Environmental Degrada-
tion and Sound Management of Chemicals
2. https://www.wma.net
3. CPME Statement on Environment and Health,
2005
4. http://cpme.dyndns.org:591/adopted/CPME_
AD_Brd_030905_100_EN.pdf
5. Collaborative on Health and the Environment
consensus statement
6. http://www.healthandenvironment.org/about/
consensus
7. Living with chemicals, Danish Ministry of the
Environment
8. http://www.mst.dk/English/Focus_areas/Liv-
ingWithChemicals/default.htm
9. Fact sheet on “Good chemistry to pregnant and
nursing mothers” at
10.http://www.mst.dk/English/Chemicals/Con-
sumer_Products/Good_Chemistry_to_preg-
nant_and_nursing_mothers.htm
Genon Jensen, Executive Director,
Health and Environment Alliance
Lisette van Vliet, Toxics Policy Advisor,
Health and Environment Alliance
The World Medical Association Council
recently held its 188th
session in Sydney.
The previous occasion was its 138th
session
which I attended as vice president of the
Australian Medical Association.
On that occasion, the Finnish represen-
tative asked of the Council, “Should the
WMA have a policy on nuclear weapons?”
The representative of a large European
country replied, “We should involve our-
selves only in matters of a strictly medical
nature”. Really? Can the responsibilities of
physicians to the health and integrity of hu-
man life, and the causes embraced by their
representative bodies, be restricted to those
of a ‘strictly medical nature’?
In answering this fundamental question lies
the relevance or otherwise of the profession
in a world so desperately in need of lead-
ership. The qualities of leadership cannot
be taught, but they can be understood. The
power is in the story.
Hanging on the wall of my Brussels office is
a large black and white photograph. I have
always hung it opposite my desk. It reminds Brendan Nelson
Leadership and the Medical Profession
wmj 3 2011 5CS.indd 108 6/21/11 9:32 AM
109
AUSTRALIA Socio-Medical-Affairs
me every day of what is really important. It
is of the late Neville Bonner, the first Ab-
original Australian elected to the Australian
parliament (Senate) in 1971. But that alone
is not why it is there.
Neville was born in 1922 on Ukerabagh
Island in the mouth of the Tweed River
in northern New South Wales. A Jagera
man, he was born there because Aboriginal
people were not allowed to be in town after
the sun had gone down. Raised first by his
mother in a hollow carved by his grandfa-
ther under Lantana bushes, he was born
into a world of great adversity.
At the age of nine,the year before his moth-
er’s death, Neville was sent to the school in
Lismore.He lasted only two days before the
non Aboriginal parents forced him out.
It was to Ida Bonner, his grandmother,
that Neville attributed his final success.
At the age of fourteen, she insisted he go
to school. He did, attending Beaudesert
School in Queensland for one year. Ida had
said, “Neville, if you learn to read and write,
express yourself well and treat people with
decency and courtesy, it will take you a long
way”.
And it did. It took him through a life of
being a stockman, labourer and scrub clear-
er. He spent eleven years on the infamous
Palm Island and then worked as a bridge
carpenter. Finally in 1971, the Liberal
Party of Australia selected him to represent
the people of Queensland in the Australian
Senate.
He had said to those who chose him, “In
my experience of this world, there are two
human qualities of which we are always in
greater need – human compassion and un-
derstanding”. He served for eleven years,
embracing many causes with conviction and
principle.Even as a Senator he endured dis-
crimination, but always argued that in deal-
ing with injustice, his people should seek to
change laws, not break them.
In 1992, asked to nominate his greatest
achievement, he replied, “It is that I was
there. They no longer spoke of boongs or
blacks, they spoke instead of Aboriginal
people”. His life is testimony to the trans-
formative, liberating power of education
and above all human virtues stands the
power of character. The Jesuits laid a foun-
dation for me, teaching me four things es-
sential for a ‘successful’ life. Commitment.
Nothing would be achieved without consis-
tent application to that in which you believe.
Conscience. Beneath every decision lies the
question, “what is the right thing to do?”
Compassion. In a literal sense it means to
share another person’s pain. In leadership,
it is to be imbued with the imaginative ca-
pacity to see the world through the eyes of
someone else. Knowing what someone else
thinks is important, but understanding how
they think is the key to effecting change.
Courage. Everything of value worth achiev-
ing demands taking a risk for others. An-
other major influence in my life is the for-
mer AMA president, Dr. Bruce Shepherd.
It was upon his shoulders and through his
courageous vision that the modern Austra-
lian Medical Association has been built.
At my first encounter with Dr. Shepherd
who had enjoyed a high, combative profile
in Australia through the 1980s, I told him
I didn’t like him. He responded, “I am go-
ing to give you a lot of advice.The first is to
never pass an opinion on someone you have
not met”.
Bruce Shepherd later taught me the im-
portance of having people around you pos-
sessed of two qualities. The first was that
they had to be ‘overenthusiastic’to the point
of having to be ‘hosed down’ a couple of
times a day.
The second quality was belief. “Surround
yourself,” he said, “with people who have
been prepared to bleed for a cause in which
they believe. That you share that cause is
less important than that they have been
prepared to give their all for their beliefs”.
When I assumed the presidency of the Aus-
tralian Medical Association in 1993, it was
a different time. Australia was emerging
from a period of virulent anti doctor sen-
timent in which the motives and incomes
were questioned as the fodder of daily polit-
ical discourse. Doctors had been embraced
as the enemy in a class struggle.
Consumerist movements – many in receipt
of government funding – were demanding
‘equity and justice’ as the nascent push to
de-medicalise the health care system gath-
ered momentum.Health financing was seen
as an instrument of control.
’Free’ healthcare was equated to ‘good’
healthcare. One half of Australia’s health-
care system funded its endless wants in out-
patient services The other half, catering for
our needs – hospital care, was seriously ra-
tioned as governments systematically with-
drew political and financial support for the
private sector.
Intra professional rivalries and resentment
of medical groups to one another with
widening income differentials concluded a
gloomy scenario. The early priorities were
policy, personnel – bringing people togeth-
er, organisational structure and the political
dimensions of the challenges ahead.
How, I asked myself, could we harness the
idealism in members of the profession to
practical achievements serving others? Ex-
ternally, we had to actively engage the po-
litical process at all levels and in doing so,
form coalitions with unlikely groups.
The AMA would have to go where it had
rarely ventured  – so called ’social policy’.
To abandon idealism was to not only court
irrelevancy, but would diminish the profes-
sion’s authority and influence in its pursuit
of its legitimate professional and industrial
interests.
wmj 3 2011 5CS.indd 109 6/21/11 9:32 AM
110
Although many of its members had dedi-
cated their lives to improving the health of
indigenous Australians, the AMA had done
little in the public policy space to address
the appalling health, premature deaths and
existential despair of the first Australians.
Spurred on by the AMA’s advocacy, the
health minister repeated to a Sixty Minutes
journalist whilst touring remote Australia,
what he had said to me privately when I
first nominated Aboriginal health as an ur-
gent, national health priority.
The journalist asked, “Why, after eleven
years in government is the situation still so
bad?”The Minister replied,“I’ve spent a life-
time reading polls,and concern for Aborigi-
nal people has not been in the top million
issues worrying the voters”.
I travelled the length and breadth of Ab-
original Australia, bringing to the con-
sciousness of middle Australia  – the
‘voters’ – the shocking circumstances of in-
digenous Australia, what should be done to
address it and admitting the prior neglect of
the profession at its representational level.
When standing in a pit of poisoned dog
carcasses to illustrate a point about a process
that had led to sick Aboriginal children, an
official hurled abuse, “that’s not the sort of
thing the president of the AMA should be
doing!” I firmly replied, “Yes, it is precisely
what the president of the AMA should be
doing”.
Similarly in tobacco control, it’s not good
enough to pass a motion, tuck it under the
profession’s collective pillow, go to sleep and
expect someone else to take up the fight. It
required leadership at public demonstra-
tions to get the industry out of sport and
debate credible business and sporting iden-
tities to have its media promotion banned.
At one point I had to hold up to Austra-
lia’s National Press Club a packet of ciga-
rettes with a barely readable health warn-
ing. Alongside it I held a packet of Ratsak
which boldly stated in black on gold, “Kills
Rats and Mice”.
That act resulted in the then government
moving the same day on new, graphically
powerful health warnings.
The health and human effects of unem-
ployment, aid programmes and rights for
women in the developing world, repeal of
laws banning homosexuality, population
and environment, boxing, gun control, fe-
male genital mutilation, illicit drugs, youth
despair, euthanasia and many other issues
were driven by the AMA.
The AMA’s political influence rose as did
its membership. But it was not supported
by all. One physician wrote, “The health
problems of Aboriginal people are social is-
sues beyond the scope and responsibilities
of doctors. Get back to health”. Another
was blunter, “As you are no longer inter-
ested in my income, I hereby tender my
resignation”.
A recently qualified anaesthetist argued that
she saw no reason to join the AMA. She
had “little in common with other doctors”
and, “unemployment and tobacco advertis-
ing had little to do with her”.
More than a few politicians told me that the
medical profession was in danger of ‘los-
ing its credibility’ because of its increasing
outspokenness on social issues that in their
opinion had nothing to do with health.
Why does any medical practitioner study
medicine, engage in research, teach and
generally strive for excellence? Surely it
is because our commitment to an ethic of
service to other human beings, as individu-
als and a community, overrides notions of a
preoccupation with our own influence and
importance.
Yes, we have obligations to individual pa-
tients, uberrima fides – to always act in the
utmost good faith. But we also have two
others. In joining the profession we assume
responsibilities for the broad, epidemiologi-
cal aspects of health.
We also have a responsibility to society
itself. Doctors must be agents of change,
challenging and changing the way our
country and world thinks about a range of
health and social issues. We must also be a
voice for those who have neither power nor
influence.
The Australian government is proposing
to legislate generic packaging of cigarettes.
In doing so, it will break the link between
the packing and the sophisticated market-
ing created by the industry that entices
pubescent young people. As they cross the
threshold to what is frequently a lifetime of
pitiable addiction, ill health and premature
death, they are drawn to an aspirational im-
age created for them.
Why should a product injurious to human
health at any level of consumption recom-
mended by the manufacturer be packaged
as if it were chocolate or perfume? Will
the WMA take up the cause knowing that
if Australia prevails over the industry, the
rest of the world will inevitably follow with
generic packaging? Another issue that the
WMA could embrace is that of newborn
deafness.
Hearing is the primary sense for commu-
nication. Today, with early screening, a co-
chlear implant and audio verbal therapy, a
baby born profoundly deaf can, by the age
of five be fully integrated into the hearing,
speaking world attending normal schools.
Yet there are those who think deafness is a
‘gift’,who consign these children to the deaf
world. Does the WMA not see a role for
itself in transforming the lives of the deaf
throughout the world as a respected, pow-
erful advocate? Gestures of intellectual in-
dependence from professional organisations
and associations mean that whatever you
stand for will remain in obscurity.
Medicine is not confined to textbooks and
journals, but extends into the life and fabric
of society itself. As such, we have an obliga-
AUSTRALIASocio-Medical-Affairs
wmj 3 2011 5CS.indd 110 6/21/11 9:32 AM
111
CollaborationNETHERLANDS/INDONESIA
Universitas Gadjah Mada (UGM) in Yo-
gyakarta on the island of Java, Indonesia
traces its origins to 1949 when a group of
Indonesian intellectuals established a foun-
dation which subsequently gave birth to the
Universitas Gadjah Mada.
UGM is the oldest and leading university
in Indonesia striving to stay on the cutting
edge of educational affairs and scientific de-
velopment. In addition, it has always been a
goal of UGM to give something back to the
community, both providing social services, as
well as producing students who are dedicated
to the greater Indonesian population. UGM
Faculty of Medicine was founded earlier
in 1946 when during the war, the medical
school in Jakarta was moved to Klaten.
The cooperation between the Universitas
Gadjah Mada (UGM) and Maastricht Uni-
versity (UM), Maastricht, The Netherlands
has a long history which can be traced back
to 1980s. Both universities have shared a
strong interest in innovation of its health
professions education, with the ultimate
purpose of making the education more rel-
evant for the societies that they serve.UGM
Faculty of Medicine
(UGMFM) has been a pioneer in educa-
tional innovation, in Indonesia and inter-
nationally, especially in community-based
education and in introducing innovative
learning formats. The Faculty was the first
to introduce small group tutorials applying
problem-based learning (PBL) methodol-
ogy in Indonesia since 1985.
In 2002, the whole curriculum was changed
into a PBL curriculum using block system,
first in its international program in medi-
cine, later also in the regular medical pro-
gram. Already in the early 1990s UGMFM
established the so-called ‘skillslab’ to train
its undergraduate students  – a develop-
ment supported by a co-operation with
Maastricht University. New government
laws in 2002 obligate all medical schools
in Indonesia to develop and implement
competence-based medical education with
a family medicine orientation. Standards of
Competence for Indonesian Medical Doc-
tor was issued by the Indonesian Medical
Council in November 2006.
Capacity Building Collaboration in the
Area of Undergraduate Medical Education:
an experience from Gadjah Mada and
Maastricht University
Geraldine van Kasteren Titi Savitri P Damardjati
tion to demonstrate an activism of caring.
In this, the WMA remains an untapped
agent of change for good.
The key is to keep an open mind, nurture
the inner integrity of your intellect and rec-
ognise that your ultimate success will derive
from the humanity shown to others.
It seems we live in a world of fundamental-
ist intolerance, in vast ignorance of the long
term consequences of decisions we make
and that are made for us. With global eco-
nomic uncertainty,tectonic shifts in geopol-
itics and rapid technological change, what
we need most is – one another.
The world needs a strong,coherent medical
voice on much more than issues of a ‘strict-
ly medical nature’. The extent to which it
does so will determine its influence and
respect. The profession has a responsibility
to shape those polls so studiously read by
our politicians. In doing so, it can change
the world.
The Hon Brendan Nelson,
13th President, AMA;
Australia’s Ambassador to Belgium,
Luxembourg and the European Union;
Australia’s Representative to NATO & WHO
wmj 3 2011 5CS.indd 111 6/21/11 9:32 AM
112
Thanks to previous innovations, UGMFM is nationally a leader in
this important change process. In order to be able to develop its
medical education further in these directions, UGMFM intended
to do a major curricular reform of which external support is needed,
especially to strengthen the knowledge and skills of staff, to monitor
the progress as well as to improve the management system which is
more compatible with the competence-based philosophy.
In the current collaboration project with Maastricht and Groningen
Universities, specific attention is given to clinical education, which
has not been standardized in Indonesia and often is of low quality.
Next to GMUFM, several teaching hospitals, district hospitals and
community health centres in the region surrounding the city of Yo-
gyakarta got supports from the project in relation to the strengthen-
ing of clinical teaching.
This includes training of hospital staff involved in clinical teach-
ing and provision of books, educational equipment and skills lab.
Another focus is continued support for developing and refining the
new curriculum, in which PBL and skills training are more con-
sistently applied and a family medicine orientation are developed.
This involves staff training, both on the spot, but also some graduate
training (masters and PhDs in medical education) in the Nether-
lands. Furthermore, it supports the development and production of
teaching materials (like so-called ‘block books’, skills lab manual,
literature references, study guide, etc) for the whole undergraduate
curriculum.
Attention has also been given to the sharing of GMUFM’s experi-
ences in medical education innovation with other 52 medical schools
throughout Indonesia through sharing of expertise in national semi-
nars, training, and study visits. Also this project contributes to the
Indonesian Medical Council (IMC) as a national regulatory body,
to be able to develop a national assessment and accreditation system
through sharing of expertise.
The overall aim of this project is to strengthen competence-based
clinical education using a Problem Based Learning strategy, to en-
hance the competencies of Indonesian medical graduates, who will
subsequently provide better quality health care.
Maastricht University,through the office of MUNDO,in collabora-
tion with Groningen University supports capacity development in
higher education in general and in medical education in particular,
through facilitating innovation of educational methods, curriculum
development, training of staff, improvement of teaching and learn-
ing resources, the establishment of new courses etc.
Whenever there is a clear demand for the expertise that Maastricht
University and its network can provide MUNDO is willing to sup-
NETHERLANDS/INDONESIACollaboration
wmj 3 2011 5CS.indd 112 6/21/11 9:32 AM
113
CPME
CPME Spring Board meeting
and General Assembly in
Brussels on 30 April
At its Spring Board meeting and General
Assembly held in Brussels on 30 April and
chaired by CPME President Dr. Konstanty
Radziwill, the CPME members came to-
gether to discuss latest items of interest for
the European Medical Profession, includ-
ing policies which look at the bigger pic-
ture of public health. The CPME inter alia
approved a document addressing health
inequalities and outlining main actions,
furthermore a position on the Innovation
Partnership for Active and Healthy Ageing,
and also a policy on climate change and its
relevance for health. However, CPME po-
sitions regarding the core business of pro-
fessional policy, like the European Working
Time directive, the Professional Qualifica-
tion directive and European Health Work-
force were discussed as well. The day before
the meeting, national experts from the
National Medical Associations addressed
policy subjects in specific working groups.
port. MUNDO is facilitating the process
and connects the experts from both sides in
teams with a shared vision of what needs to
be accomplished. In MUNDO we believe
that real capacity development, especially
in higher education, is more than doing a
project. It is about establishing open mind-
ed partnerships based on equity, reciprocity
and mutual respect.
Such partnerships enable academics and
students to step over institutional and coun-
try borders, and engage in a free flow of
knowledge and ideas for the advancement
of their own country as well as the global
society.This we believe is sustainable capac-
ity development.
During the course of this Project funded by
the Dutch Government, trust and sincer-
ity have grown out of those involved which
have overcome some obstacles.
Lessons learnt from this long collaboration
between the universities are first of all that
a strong basis of mutual trust and respect
is required to have effective exchanges of
ideas. This can only be built in the course
of time, patient is needed. Secondly strong
leadership is indispensable for a change
process to have the chance to succeed.Man-
agement capacities in the organization are
equally important to be able to feel the im-
pact of increased capacity of the individu-
als in the organization. A good monitoring
system needs to be developed both for the
project as well as for the faculty. An open
communication system (internal and cross
cultural) is needed to ensure developments
are shared and understood.
Lastly an intensive collaboration project is
a great learning experience for all project
members involved; theories and methods
that might already be implemented in one
institute need to be redesigned or adapted
for the other to be useful, a copy-paste ap-
proach is doomed to fail.
Only persons who are open minded and
are capable of modifying their views and
opinions to a changing context will suc-
ceed in capacity building with a sustain-
able impact.
Titi Savitri P Damardjati, Vice Dean
of Academic Affairs Universitas Gadjah
Mada Faculty of Medicine, Indonesia
& Geraldine van Kasteren, Mundo,
Maastricht University, The Netherlands
News from the CPME
(Standing Committee of European Doctors)
CPME represents the National Medical Associations of 27 countries in Europe and works closely
with the National Medical Associations of countries that have applied for EU membership as well
as specialized European medical associations
Konstanty Radziwill Birgit Beger
wmj 3 2011 5CS.indd 113 6/21/11 9:32 AM
114
CPME
Dr. Paul Timmers from the European
Commission DG Information Society
and Media (Director of Directorate H:
ICT addressing Societal Challenges) was
invited as a guest speaker and addressed
the EU eHealth Policy Developments and
the Innovation Partnership on Active and
Healthy Ageing, a Flagship initiative from
the European Commission involving three
Directorate Generals (DGs): DG Health
and Consumers, DG Information Society
and DG Research. The CPME is member
of the Steering Group for the Innovation
Partnership.
This article aims at highlighting a few of the
many topics disussed at the fruitful CPME
spring meetings.
Innovation Partnership on
Active and Healthy Ageing
CPMEs’Statement on ‘the European Inno-
vation Partnership on Active and Healthy
Ageing’ sets out main points for action for
a successful planning and execution of the
next stage within the European Innovation
Partnership on Active and Healthy Age-
ing.The overall outcome set by the EU is to
increase healthy lifespan in the EU by two
years by 2020. According to CPME, much
of the “innovation” required will not be a
new form of telemonitoring or telemedi-
cine, (although these are clearly important,
and will drive the involvement of indus-
try), but a new way of working horizontally
across different clinical disciplines and sec-
tors. CPME suggests identifying pathways
for piloting that have established clinical
management, role identification, measur-
able outcomes and a degree of patient in-
volvement.
While “hard” evidence of improved out-
comes is essential,“soft”evidence is also im-
portant. These include more qualitative as-
sessments, such as independence, increased
confidence in self-management, and re-
duced isolation. Workforce issues of health
professionals, as well as innovative tech-
nologies, a sustainable health policy even in
times of financial crises for the health care
systems are decisive elements for any strat-
egy of the innovative partnership from the
doctors’ point of view.
Health Inequalities
In an own initiative position paper which is
based on a survey among CPME members,
the CPME addresses three major reasons
for caring about health inequalities. The
first is that avoidable health inequalities are
simply and many would say immorally un-
fair. The second is that avoidable health in-
equalities often infringe an internationally
acknowledged human right to health. The
third is that health inequalities are econom-
ically costly – societies with smaller health
disparities do better in economic terms than
societies with wider health inequalities.
As an organisation of medical doctors,
CPME concentrates its lobbying activities
on health related issues to reduce inequali-
ties and give priority to the following mea-
sures: improving the data and knowledge
base and mechanism for measuring, moni-
toring, evaluation and reporting; improve-
ment in infrastructure, especially water
and housing; improved maternal and child
health care; securing the right to health for
disadvantaged people including illegal im-
migrants and asylum seekers.
At the National Medical Associations’
(NMA) level, CPME recommends that
NMAs contribute to the reduction of social
gradients by drawing government attention
to the ratification of international conven-
tions or charters that secure the right to
health and lobby health authorities for bet-
ter healthcare, particularly for the disadvan-
taged people.
The survey on health inequalities conduct-
ed by CPME among its members in 2010
showed that the social determinants are
often more important than differences in
access to health care. The main reasons for
health inequalities are the social gradients.
European Health Workforce
The European Health Workforce is encoun-
tering the problem of shortages of workers
and workers’ mobility. The European Com-
mission has established that in 2020, 1 Mil-
lion health care professionals will be miss-
ing in the European Union. The CPME
believes that there is a need to offer more
attractiveness to the medical profession by
giving good working conditions and good
pay. To assess the current situation, a first
step the CPME will undertake is to gather
data among national medical associations.
The CPME will closely monitor further de-
velopments in the review process and will
take an active stand for the interests of the
healthcare workforce and their patients.
European Working
Time Directive
In response to the review of the Working
Time Directive 2003/88/EC, the CPME
restated its previous position that the opt-
out clause is to be abolished.On-call time is
working time as stipulated by the European
Court of Justice as well as compensatory
rest has to be granted immediately follow-
ing longer working periods.The CPME co-
signed and submitted these comments on
the review of the Working Time Directive
together with AEMH (European Associa-
tion of Senior Hospital Physicians), EANA
(European Working Group of Practitioners
and Specialists in Free Practice) and FEMS
(European Federation of Salaried Doctors).
Task shifting
The CPME adopted a policy on the impact
of task shifting on doctors in training which
wmj 3 2011 5CS.indd 114 6/21/11 9:32 AM
115
CPME
calls for adequate training opportunities for
junior doctors. CPME recommends that
each member state ensures that adequate
training opportunities are ring-fenced for
doctors in training and that the wider im-
pact of task shifting is investigated in order
to ensure that patients receive care from the
most appropriate health professionals with-
out compromising on education and train-
ing standards for doctors in training.
Recognition of Professional
Qualifications
European physicians welcome the three
challenges set by the European Commis-
sion in the revision of Directive 2005/36/
EC on professional qualifications. These
challenges – simplification of the existing
system of recognition of professional quali-
fications, facilitation of the access of profes-
sionals to the internal market, and enhance-
ment of trust in the system – enjoy the full
support of European physicians.
The CPME supports greater transparency
of training contents specified at national
level instead of a ‘European’ curriculum for
training.
eHealth
The delegations decided to consider the
CPME note on a professional electronic ID
card for doctors as a basic document for fur-
ther developing its policy.
CPME has participated in the Steering
Group by the European Commission on
the professional ID card, which started in
January 2011 in the context of the revision
of the Professional Qualification Directive.
The CPME will continue its work on assess-
ing the scope of applications of an electronic
ID card for professionals and is engaged in
a debate on how to prepare European doc-
tors for the challenges of eHealth.
Currently, CPME is involved in the
‘eHealth joint action in the eHealth Gover-
nance Initiative’ and the EU funding proj-
ect ‘Chain of Trust’ which aims at a better
understanding of challenges from a users’
point of view (including doctors, patients,
nurses, pharmacists), including the national
and regional level.
Climate Change
The CPME delegations adopted a position
paper on climate change which calls for de-
veloping evidence of a substantial and mea-
surable benefit to health arising from green-
house gas reduction, and will encourage its
members to lobby for inclusion of the eco-
nomic and health benefits in the Durban
COP17 agreement. The Durban COP17
agreement is expected to be adopted at the
next United Nations conference on climate
change (COP17) in Durban at the end of
this year.
The CPME position paper underlines that
what was almost universally apparent was
that little is understood about the beneficial
effects to health brought about by green-
house gas reduction. It is essential that doc-
tors within the EU give more leadership on
this issue.
The CPME can play a role in (a) publicis-
ing these benefits at both EU and Member
State level, (b) influencing national gov-
ernments to place these co-benefits on the
Durban agenda, (c) encourage further work
to be done on analysis at MS level, and (d)
influencing national negotiators.
Apart from this, the CPME is involved in
the Commission Working Group on Green
Infrastructure organised by DG Environ-
ment. This initiative has been created out
of concern for the effect climate change
will have on biodiversity. The uncertain ef-
fects on infectious disease transmission and
prevalence is just one example of a damag-
ing biodiversity impact, but CPME’s mem-
bership has been additionally welcomed
because of its interest in co-benefits, and
therefore expertise in emphasising within
new Commission work a “health in all” ap-
proach to all the EU’s climate change work.
Pharmaceuticals
Revision of the Clinical Trials Directive
2001/20/EC
In its response to the consultation, the
CPME in general agreed with the revision
of the ‘Clinical Trials Directive’ 2001/20/
EC as proposed by DG Health and Con-
sumers, but underlined inter alias that there
should be one single framework for all clini-
cal trials considering certain variations, e. g.
as to non-interventional trials taking into
account the protection for patients and
the respective workload involved. The non-
commercial/academic investigators should
receive some financial or other support in
order to cope with the administrative work-
load. However, also in view of the recent
pharmacovigilance legislation 2010/84/EU,
in any case, a “race to the bottom” needs to
be prevented i. e. requirements for clinical
trials must not be diminished.
New CPME Members
At its spring meeting, the CPME accepted
the application of the Albanian Order of
Physicians and welcomed them as new ob-
server member to the CPME.
Next CPME meetings
The Autumn CPME Board meeting and
General assembly will take place in Brussels
on 26 November 2011.
Dr. Konstanty Radziwill, President, CPME
Birgit BEGER, Secretary General, CPME
E-mail : birgit.beger@cpme.eu
wmj 3 2011 5CS.indd 115 6/21/11 9:32 AM
116
Socio-Medical-Affairs UNITED KINGDOM
Can you imagine a time when the experi-
ence of millions of patients, families and
care givers has been fundamentally trans-
formed?
For example,there would be no-one waiting
unnecessarily for care; an end to the mil-
lions of unnecessary patient visits; hospital
bed days and clinician tasks eliminated; care
provided is reliably ‘right first time’  – in-
stead of the typical 40–45% defect rate; and
staff have stopped ‘firefighting’ and concen-
trate on quality care.
All this is actually happening somewhere
in health systems today. Around the world
people working in every aspect of health-
care services have been innovating,resulting
in efficiency, productivity and exceptional
care for patients. However, the fact that it
is not standard everywhere is a major chal-
lenge which requires innovation. I will re-
turn to this later.
Innovation
What do we mean by innovation in the
context of health services and can innova-
tion really lead to efficiency and productiv-
ity? This is a question that I get asked many
times by colleagues from both within the
National Health Service (NHS) and across
the world. My answer is always “yes, it can”.
Anyone involved in innovation will know
that the mere mention of the word will
evoke a debate about its meaning. If you
seek a definition through a search engine
such as Google, you will be rewarded by at
least 61,800,000 returns [1]. I would argue
that the word itself is actually not that im-
portant, and instead of getting hung-up on
semantics, we need to focus on the people
who want to be innovative and what it
means to them in their particular context.
Within the NHS, we often start discussions
with local teams by describing innovation as
“Doing things differently and doing different
things, to create a step change in performance”
[2] before moving to explore exactly what
this might mean for their challenges and
aspirations in their local context.
In health services we need innovation in
technology and clinical devices, informa-
tion systems, care processes and organisa-
tional systems to name a few. All of these
play their part and are integral to the way
that health services are delivered.
The increased need
for innovation
The benefits of innovation have been ar-
ticulated by many [3, 4] and innovation has
been cited as a major contributor in turn-
ing around challenged or ailing organisa-
tions [5].The recent financial crisis has cre-
ated increasing pressure on health budgets,
many of which have been reduced or in the
least remain static. For example, the NHS
in England has enjoyed a decade of unprec-
edented growth at an average rate of 6.6% a
year [6] but is now facing the challenge of
reducing its financial expenditure in order
to achieve in an environment of rising costs,
expectations and health needs. This reduc-
tion represents the need for health services
to effectively reduce expenditure by £20 bil-
lion in the next three years.
For some, the economic crisis will result
in actions that represent pure cost cutting,
which often leads to compromised quality
and rarely results in innovation. However,
for others it can actually provide a fertile
platform for innovation by stimulating
organisations to engage in conscious and
deliberate thought about how to meet the
need to deliver higher quality care with
fewer resources. It is in this type of envi-
ronment that a crisis can stimulate innova-
tion which in turn can result in new ways of
providing services and new ways of working
at reduced cost, while increasing the quality
of care.
Leadership responsibility
Innovations often emerge from front line
staff [7] and there is a massive leadership
responsibility in supporting this to enable
it to happen. Leaders have a disproportion-
ately large effect on the cultures of organ-
isations and systems, and need to signal to
staff, through communication and action,
that they are seeking and supporting inno-
vations in order to overcome current chal-
lenges [8].
In a recent study [10] within the NHS,
two thirds of staff respondents stated that
they were not adequately supported by se-
nior leaders to undertake innovation and
Innovation, Efficiency and Productivity in
Health Services…
Keynote speech at the Innovation in Healthcare: Improving Care, Driving Efficiency confer-
ence. 12th
May 2011, the Barbican, London
Lynne Maher
wmj 3 2011 5CS.indd 116 6/21/11 9:32 AM
117
Socio-Medical-AffairsUNITED KINGDOM
improvement activities. If staff do not feel
supported, they are much less likely to be
inspired to have or try out new ideas.
“…Strategies and processes alone are not
sufficient to drive the degree of change
we are seeking….the NHS should focus
on tackling the behaviours and cultures
in the system that stand in the way”. Sir
David Nicholson, Chief Executive of the
NHS. NHS Annual Report 2009 [9].
Many leaders believe that they do support
staff and here lies a problem: a disconnect
between what is believed by leaders and
what is happening from the perspective of
staff. A new diagnostic framework which
identifies seven dimensions that are impor-
tant and influential to the culture for in-
novation in organisations has proven to be
useful for staff, who can share their views
on how supported they feel, and for lead-
ers who, when furnished with information
from the survey, can better understand how
to create a culture where innovation can
flourish.
Seven Dimensions of Innovation Culture
[8]
• risk taking
• resources
• knowledge
• goals
• rewards and recognition
• tools and methods
• relationships
RiskTaking is about establishing an organ-
isational climate where people feel free to
try out new ideas by judging any risks ap-
propriately. Leaders in innovative organ-
isations demonstrate that they are more
interested in learning from ‘failure’ than in
punishing it.
The Resources dimension considers the
broadest sense of the word. The climate for
innovation is enhanced if people know that
they have the ‘resource’ of authority and au-
tonomy to act on innovative ideas, as well as
some financial resource to support the new
work.
Broad-based Knowledge is the fuel for in-
novation. We create better conditions for
innovation when information, from both
within and outside the organisation or sys-
tem, is widely gathered, easily accessible,
rapidly transmitted, and honestly commu-
nicated.
Contrary to what some may believe, the
literature clearly shows that Goals can ac-
tually support innovation. Organisational
and system leaders should signal that inno-
vation is highly desirable by setting aspira-
tional goals in specific areas, and challeng-
ing teams to find ways to realise the vision.
Rewards for innovation are symbols and
rituals of which the main purpose is to rec-
ognise innovative behaviour. Because it is
all about encouraging more of this sort of
behaviour, the best rewards are those that
appeal to people’s intrinsic and individual-
ised motivation.
In high-performing organisations, innova-
tion is the product of the deliberate use of
practical Tools. Leaders need to consider
how they build capability and capacity in
deliberate methods for creative thinking,
idea management and implementation.
“Undervaluing and under investing in
the human side of innovation is a com-
mon mistake”.
Rosabeth Moss Kanter 2006 [11]
The Relationships dimension refers to the
patterns of interaction in the organisation
or system. Innovative ideas are rarely the
product of a lone genius, therefore environ-
ments where staff are routinely exposed to
a wide range of different thinking, from a
wide-range of people, with a wide range of
backgrounds and points of view, provide
rich soil for the growth of innovation.
A mindset of abundance
In times of austerity,we often focus on what
we feel we do not have; for example, we feel
we don’t have enough financial resource,
we don’t have enough beds, we don’t have
enough clinical staff, we don’t have enough
choice to provide the type of services that
we would like to. This leads us into a spe-
cific mindset which can result in a down-
ward spiral of negativity and despondence
and in turn, this can result in a reduction
of performance in staff and ultimately the
organisation. It is exactly at times of con-
straint that we should focus on what we do
have and ensure that we use those resources
wisely. Paul Batalden said,“We should work
not from an assumption of scarcity,but from
an assumption of abundance” [12]. Within
the NHS for example, we know that we
have an abundance of highly skilled nurses,
just over 400,000 of them. How can we as
leaders help those 400,000 nurses help us to
achieve the transformational change that is
needed in our system? How can we encour-
age them to identify new ways to provide
care that increases quality and at the same
time reduces cost?
Would words such as “let’s start a new cost
improvement programme” or “we are stop-
ping the employment of all temporary staff”
or “you need to reduce consumables in-
cluding stationary in order to reduce costs”
inspire those nurses who want to provide
the best care that they can to patients and
their families? The answer is no, this will
lead them into the mindset of cost cutting.
However, there is a massive opportunity
to harness the will, the skills and exper-
tise of thousands of nurses and this can be
achieved by focussing on the way any par-
ticular challenge is framed. By making it
clear to staff, through communication and
action, that innovation is needed in order
to overcome current challenges, leaders can
wmj 3 2011 5CS.indd 117 6/21/11 9:32 AM
118
utilise the abundance of nursing resource to
achieve organisational goals. When com-
municating the challenge, it needs to be
obvious that new ideas are desirable and
that the aim is not to just tinker with the
status quo or apply a blanket cost cutting
formula. Staff need to understand what and
how they as individuals or small teams can
actually contribute.
If we return to the current NHS challenge
of maintaining high quality care while re-
ducing costs by £20 billion over the next
three years and articulate that to ward staff,
it simply feels too overwhelming. It is a
leadership responsibility to help staff to be
able to effectively understand what all of this
means for them. One way of achieving this
is through effective communication which
frames the challenge and aspiration in a way
that is more tangible and achievable within a
local context. For example, rather than only
articulate the high level challenge of reduc-
ing costs across the whole NHS (the £20
billion) leaders need to be able to identify
what their organisation – down to the detail
of each ward and department – can contrib-
ute (Table 1: Framing to engage staff).
Designing services with
patients and family members
Following the theme of abundance, we also
need to recognise both the sheer volume of
patients and family members and the valu-
able input they can provide. In conversa-
tions with colleagues at the Design Council
in London about designing services with
customers, the group reflected that ‘Patients
and families are the biggest untapped resource
in the NHS’.
By working in partnership with patients,
using methods that have been adapted from
the service design industry, staff have been
able to demonstrate many changes that
have had a fundamental impact on health
service delivery. For example, when focus-
sing on the actual experience of being part
of a health care process (rather than focus-
sing on the process primarily from a clinical
perspective) one service, which was consid-
ered to be one of the best performing within
an organisation, made 42 improvements,
including removing steps in the process,
which added no value to the patient, and
improving safety – both of which reduced
overall cost. A primary care organisation
considered transferring neurological servic-
es into the community in order to bring care
closer to the homes of patients living with
multiple sclerosis (MS). It was thought that
this option would increase quality, although
it was actually more expensive than the cur-
rent provision. After working with people
living with MS and their families, they dis-
covered that this would not improve ‘their’
experience, it would actually make things
more difficult. With the current system pa-
tients were able to co-ordinate their various
health needs into one visit to the hospital,
the change would mean they still needed to
make a trip to the hospital and in addition,
they would have a trip to the community
unit, resulting in an additional visit from
their perspective.
The real problem for those living with MS
was getting specialist information and other
help – advice about benefit payments, help
with movement or repairing wheelchairs
and other equipment. The primary care
organisation had good intentions, however
their proposed solution was more expensive
and it did not provide a better experience
for patients, the actual customers of the
service. The result of working closely with
patients and family members was in fact to
maintain the existing hospital consultant
led service but patients and staff worked
together to explore new and more effective
ways to access services and information that
they needed and this led to the develop-
ment of a new social network site that they
designed together [13].
Learning from other industries
We also have to remember that patients
and their families bring not only their per-
spective of experiencing health services,
they can also offer knowledge and expertise
from other aspects of their daily life – such
as their work roles. Innovation often oc-
curs through the adaptation of something
common to one industry, which is new to
Table 1. Framing to engage staff
From To
• The NHS needs to reduce its costs by
£20 billion
• As an organisation, we need to contrib-
ute to the overall cost reduction for the
NHS
• Everyone needs to work within the new
Cost Improvement Programme (CIP)
• We are launching a ‘call for ideas’ from all
staff and patients and their families
• With immediate effect there will be no
employment of temporary staff
• We need new ideas that could maintain
quality and reduce cost on each ward by
at least £11,000 this year; if we can save
more, that would be even better
• All staff must reduce consumable use in-
cluding stationary
• These ideas could be about reducing
waste, changing the way we work or
looking at the materials we use, for ex-
ample
Socio-Medical-Affairs UNITED KINGDOM
wmj 3 2011 5CS.indd 118 6/21/11 9:32 AM
119
another. There are many illustrations of this
within the NHS, for example, when explor-
ing how to improve safety, a checklist was
adapted from the aviation industry and is
now being used by both airline pilots and
surgeons alike. Tools and techniques for
understanding customer experience have
been adapted from the service design in-
dustry and lean methodology is now almost
commonplace after being adapted from the
manufacturing industry.
It is this last example that has particularly
yielded improvements in efficiency and ef-
fectiveness. The NHS Institute for Inno-
vation and Improvement has utilised lean
methodology within a variety of health care
settings in order to increase productivity
and release time for professionals to focus
on high value-adding activity. The Produc-
tive Series [14] incorporates seven pro-
grammes designed to support different ar-
eas within health services. All have resulted
in an increase of efficiency, productivity and
quality at lower cost.
When using the Productive methodology
[14], hospital ward teams report an increase
in direct patient care time by 40%. This
means nurses spending more time with pa-
tients, less time on administration increas-
ing their ability to create more capacity for
value-added work. Unplanned staff absence
rates dropped by 6% in organisations using
the ‘productives’, which not only represents
a cost saving, but indicates an increased
positive feeling for staff.
In addition to increasing quality, the pro-
grammes can also lead to the reduction
of cost. The Productive Operating Theatre
programme can provide an average trust
with an improvement opportunity of over
£7 million through, for example, the reduc-
tion of waste, increase in safety and more
efficient scheduling. The Productive Leader
tools can help staff free up between 40 and
46 days per year in eliminating tasks that
were actually ‘wasteful’. Although early in
its development, the Productive General
Practice has already identified both qualita-
tive and quantitative improvements.
The Productive Series [14]
Productive Ward
Productive Community Hospital
Productive Community Service
Productive Leader
Productive Mental Health Ward
Productive Operating Theatre
Productive General Practice – in deve-
lopment
I will now return to the beginning of this
paper and the issue of what is happening
‘somewhere’… In healthcare we have ex-
amples where the experience of millions of
patients, families and care givers have been
transformed  – for example; where no-one
is waiting unnecessarily for care, an end to
the millions of unnecessary patient visits;
hospital bed days and clinician tasks elimi-
nated; care provided is reliably ‘right first
time’ – instead of the typical 40–45% defect
rate; and staff have stopped ‘firefighting’and
concentrate on quality care.
If only these innovations that have the po-
tential to significantly impact on quality
and cost were implemented on a large scale,
in every healthcare organisation, the result
would be a true and radical transformation
of services. Unfortunately this is not the
case, but rather we see ‘islands of improve-
ment’ when we desire a sea of transforma-
tion. There is a massive amount of innova-
tion within health services; our next big
challenge is to focus our attention on new
ideas that could break the physical and be-
havioural barriers impeding the widespread
‘adoption’ of these innovations into routine
practice.
Can NHS staff achieve ever increasing
quality and productivity and bring about
a health service more focussed on the in-
dividual needs of patients? Yes, they can –
and we know this because some are already
doing it.
References
1. Google – www.google.co.uk accessed 30th
April
2011.
2. Maher, L., Plsek, P., Bevan, H. (2008). Making
a bigger difference: a guide for NHS front-line
staff and leaders on assessing and stimulating
service innovation. NHS Institute for Innova-
tion and Improvement. Coventry.
3. Bason, C. (2010). Leading public sector innova-
tion: co-creating for a better society. The Policy
Press. Bristol.
4. Christensen, C. (2009).The innovators prescrip-
tion. McGraw Hill. New York.
5. Christensen,C.(2003).The innovators dilemma.
Harper Business Essentials. New York.
6. Appleby, J., Crawford, R., Emmerson, C. (2002).
How cold will it be? Prospects for NHS fund-
ing: 2011-17. King’s Fund, Institute for Fiscal
Studies. London.
7. Bessant, J. (2003). High-involvement innova-
tion: building and sustaining competitive ad-
vantage through continuous change. Wiley,
England.
8. Maher, L., Plsek, P., Price, J., Mugglestone, M.
(2010). Creating the culture for innovation: a
practical guide for leaders. NHS Institute for
Innovation and Improvement. Coventry.
9. Nicholson, D. (2009). Cited in the NHS Annual
Report. HMSO 2009. London.
10. NHS Institute for Innovation and Improvement
Survey 2009 report. Available at www.institute.
nhs.uk/innovation
11. Kanter, R. M. (2006). Innovation: the clas-
sic traps. Harvard Business Review. November.
USA.
12. Berwick, D. (2004). Escape fire. Designs for the
future of health care. New York: John Wiley &
Sons, Inc., 272–295.
13. NHS Institute for Innovation and Improvement
(2009). Experience based design. www.institute.
nhs.uk/ebd
14. NHS Institute for Innovation and Improve-
ment: the productive. Available at http://www.
institute.nhs.uk
Dr. Lynne Maher,
Interim Director for Design and Innovation
NHS Institute for Innovation
and Improvement
E-mail: lynne.maher@institute.nhs.uk
Socio-Medical-AffairsUNITED KINGDOM
wmj 3 2011 5CS.indd 119 6/21/11 9:32 AM
120
IT Policy AUSTRALIA
Health IT or EHealth as it is called in
many parts of the world is predicted to
radically improve the delivery of health-
care. However, its implementation has
been difficult, and despite billions of dol-
lars being spent around the world there
is still much conjecture about whether it
can meet its promise. Australia, the United
States and almost every other Western
country has invested in it, and is looking
for outcomes. However, the policy aspect
of it has not advanced as fast as the tech-
nology aspect.
In recent times, under the Obama adminis-
tration a renewed initiative has taken place
in the United States, which I believe has
been a great leap forward in connecting the
policy with the technology.
Whilst criticized for the amount of money
invested, which was as much driven by a
need for health reform as it was from a need
to stimulate the economy during the great-
est economic downturn since the Great
Depression, it has awoken interest in the
effective use of information technology in
healthcare, and potentially set a new bench-
mark for the rest of the world.
I recently spent a week at the Harvard
School of Public Health where I attended
a residential course on Leadership Strate-
gies for Healthcare IT. The course was run
by two gentlemen who are fairly legendary
in the world of ehealth.
Dr. John Glaser, the former CIO of Part-
ners Health, the amalgamation of Mas-
sachusetts General Hospital and Brigham
and Women’s Hospital in Boston, which
now includes several more facilities and
some 6000 physicians in Massachusetts
and adjoining states.
Dr. Glaser was called upon by the US gov-
ernment in 2009 to draft the meaningful use
provisions of the ehealth legislation. And
Dr. John Halamka, CIO of Care Group,
the amalgamation of Beth Israel Deaconess
hospital and several other hospitals in the
region with over 2000 physicians. He is also
CIO of Harvard Medical School and heads
a number of government initiatives in the
US.
You may ask why focus on the USA when
it is recognized that their healthcare system
is in trouble. The Commonwealth Fund re-
ports that despite being the most expensive
in the world the quality of their healthcare
ranks amongst the lowest [1].
This has been recognized by the govern-
ment and heath reform, as we are all aware,
is a very hot topic in the USA today. It is an
area that they have focused on, and quot-
ing Sir Winston Churchill,“You can always
count on Americans to do the right thing –
after they’ve tried everything else”. I believe
they are now at that stage.
So there are three facets of ehealth policy I
want to explore.
The first is the concept of Meaningful Use
[2]. In 2009 President Obama and the US
Congress passed ARRA, the American Re-
covery and Reinvestment Act which pro-
vided almost $800 Billion to stimulate the
US economy in response to the Global Fi-
nancial Crisis of 2008.
Within that legislation was some $25 Bil-
lion for ehealth. However, the genius of the
legislation was the need for the recipients
of this funding to demonstrate ‘Meaningful
Use’ of the technology to be eligible. At the
time the legislation was enacted meaningful
use had not been defined? Dr. John Glaser
and others were seconded to Washington to
the office of the National Coordinator for
Healthcare Information Technology, an-
other Bostonian Dr. David Blumenthal to
develop the definition.
The key issue is that the meaningful use
criteria do not relate to technology, but
rather to health outcomes and the accurate
and timely reporting of this data. They are
also staged, phase one, whilst not trivial will
allow most physicians to get onboard by
2011, but stage 2 extends into disease man-
agement, clinical decision support, patient
access and empowerment and improved
bi-directional communication, while stage
3 focuses on aggressive quality safety and
efficiency improvements and population
health outcomes.
Linking clinical outcomes to ehealth is the
key to the successful implementation in the
USA, and we have seen a radical shift in the
thinking of ehealth companies over the last
year or so with this focus on meaningful
use.Tying the reimbursement to the desired
outcomes, basic Pavlovian psychology has
driven this change.
What Australia (and the Rest of the World)
Can Learn from US Health IT Policy
George Margelis
wmj 3 2011 5CS.indd 120 6/21/11 9:32 AM
iii
IT PolicyAUSTRALIA
The second concept is that of ‘Bending the
Curve’, a term used by President Obama in
the 2009 State of the Union address, refer-
ring to slowing down the rapid increase in
US healthcare costs[3]. The issue is not just
the gross increase in spending, but the het-
erogeneity of this spending.
Highlighted by an article in the New York-
er by Dr. Atul Gawande [4], a Boston sur-
geon with a knack for incisive writing on
health matters. In this article he talks about
McAllen, Texas, a town with the dubious
distinction of being one of the most ex-
pensive healthcare markets in the country,
second only to Miami. Its other claim to
fame is being the Square Dance Capital of
the World.
You may argue that the New Yorker is not
the best peer-reviewed journal for health
policy around, and I would agree, but
Dr. Gawande has used it very effectively to
take much of the work published in Health
Affairs and other learned journals and bring
it to the attention of the government and
the lay press.
The debate has now arisen on how ehealth
can aid in flattening the discrepancies in
healthcare spending in the US by the shar-
ing of information,the ability to compare in
near real time services, costs, outcomes and
use that to influence the provision of high
quality care.
Dr. Gary Gottlieb, the CEO of Partners
Healthcare spoke at the event about the
need for a High Performance Learning
healthcare system. To enable those clini-
cians need to be able to share information
and learn from each other in a non confron-
tational way. Ehealth provides that oppor-
tunity.
The third issue is the ‘Accountable Care Or-
ganization’, a new concept where healthcare
providers form an ACO and provide care.
They can be paid by capitation or fee for
service, but they also receive reimbursement
for reducing costs and meeting quality im-
provement markers.
In this way they are accountable to the pa-
tients and the third party payer for quality,
appropriateness and efficiency of healthcare
provided.
In Australia, these may equate to our Medi-
care Locals or even our Super Clinics,but in
the US there has been a lot of work defining
them, and also working out the ehealth im-
plications. ACOs do not need to be physi-
cal entities; they can be virtual entities that
take advantage of advances in ehealth tech-
nologies, including technologies that allow
healthcare workers to reach right into the
homes of patients.
Again Atul Gawande has led the way in
publicizing in the lay press what ACOs
can achieve [5]. In an article in last week’s
New Yorker called “The Hot Spotters” he
looked at how innovative care models have
significantly decreased the costs of care
and significantly improved the quality. It
basically comes down on concentrating re-
sources where they make a difference and
focus.
So what are the three lessons we can take
from these ehealth policy perspectives from
the US?
1. Set goals that are relevant to politicians,
providers, patients and technologists so
that they can all aim at the same goal.
Don’t set different goals for different
groups; you need to unite them with a
common goal. Meaningful use did that
in the US.
2. Publicize the problem so everyone can
understand. Don’t lock it into articles
in the MJA; get it out in a way everyday
people can understand. Atul Gawande
is a good example; his work ended up
in the NY Times, the LA Times, Time
magazine and became an issue of discus-
sion in the lay press, the medical press
and even the IT press. Make sure every-
one knows what the problem is.
3. Define a solution and work towards it.
It may not be perfect, it may not even be
right, but a focused solution people can
deliver to is better than a weighty strat-
egy which people will debate forever.The
ACO is the embodiment of healthcare
reform, and people are developing them
as we speak.
References
1. Anderson G. & Squires D. Measuring the U.S.
Health Care System: A Cross-National Com-
parison. Commonwealth Fund Issues in Inter-
national Health Policy. June 2010.
2. HIT Policy Committee Department of Health
and Human Services. Meaningful Use Work-
group Presentation. July 16, 2009.
3. Paterson D. Act II – Curve Bending. N Eng J
Med 2009: 361: e116.
4. Gawande A. The Cost Conundrum. The New
Yorker, June 1, 2009.
5. Gawande A.The Hot Spotters.The New Yorker,
January 17, 2011.
Dr. George Margelis MBBS,
M.Optom GCEBus;
Care Innovations
An Intel GE Company
E-mail: george.margelis@careinnovations.com
wmj 3 2011 5CS.indd Sec2:iii 6/21/11 9:32 AM
iv
“The Speaking Book created for low literacy health education re-
ceives the prestigious TIGA Award – (Technology in Government
Awards) from the UN Economic Commission for Africa.”
The Awards, according to the Information and Communication
Service of the Economic Commission for Africa (ECA) are co-
organised by the Economic Commission for Africa (ECA) and the
Government of Finland in collaboration with the eLearning Africa
Scholarship Trust, the organizer of the eLearning Africa annual
event. The awards are given in recognition of initiatives aimed at
exploiting information and communication technologies (ICTs) for
education and training in Africa.
“The second leg of the long-awaited 2011 Technology in Govern-
ment Awards (TIGA) in the ‘ICT in Education’ category were
celebrated at a high-profile event and ceremony, Friday morning.
Over 1,400 participants from about 80 countries are attending the
eLearning Africa, 6th International Conference on ICT for Devel-
opment, Education and Training, at the Mlimani City Conference
Centre, Dar es Salaam,Tanzania.
In remarks read by his representative at the ceremony,ECA’s Execu-
tive Secretary and UN Under-Secretary-General,Mr Abdoulie Jan-
neh said, “today we see signs that more and more ICT applications
are being integrated in all sectors in Africa including in government,
education, health and in the economic sectors.”
He, however, noted that whilst the adoption of ICTs in education
in Africa is on the increase, “it is a fact that the continent still falls
behind, which is why these awards are so important.” He added, “It
is indeed necessary for the youth in Africa to gain acquainted with
the 21st century skills in order to increase the competitive advan-
tages of Africa.”
The Speaking Book project aims to make education about critical
issues accessible to all regardless of literacy or education level. This
‘world first’ is created by South Africans for Africans and focuses
on rural, vulnerable and excluded people living in disadvantaged re-
gions of Sub-Saharan Africa and communities around the world.
Improving health care is a top priority for Africa and through the
Speaking Books ( www.booksofhope.com),access to essential medi-
cal information for low literacy, rural,and vulnerable Africans is im-
proved.
“Receiving this TIGA Award recognizing the impact and impor-
tance of the Speaking Book is a great honor for us, as well as all our
sponsors from the Pharmaceutical Industry, Government Health
Departments, and major NGO’s, for their support to ensure that
disadvantaged communities are able to obtain and understand criti-
cal health education.Their support has made it possible for Speaking
Books to be distributed throughout Africa, in India, China, South
America and the USA, and covering 45 titles in 15 languages” says
Brian Julius, Director of Books of Hope.
For further information, please contact Brian Julius
info@booksofhope.com
Speaking Book Takes UN Award for Education and Training
Contents
Editorial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
Global Forum on Human Resources for Health . . . 82
Violence in the Health Care Sector – A Global
Issue . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Physician Suicide and Resilience: Diagnostic,
Therapeutic and Moral Imperatives . . . . . . . . . . . . . 90
Whole Genome Sequencing – a New Paradigm
for Clinical Care? . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
Overview of the Vaccines in Preventing
Infectious Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . 103
Why Cancer Prevention isn’t Working
Well Enough . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106
Leadership and the Medical Profession . . . . . . . . . . 108
Capacity Building Collaboration in the Area
of Undergraduate Medical Education. . . . . . . . . . . . 111
News from the CPME . . . . . . . . . . . . . . . . . . . . . . . 113
Innovation, Efficiency and Productivity in Health
Services… . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116
What Australia Can Learn from US Health
IT Policy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 120
wmj 3 2011 5CS.indd Sec2:iv 6/21/11 9:32 AM